EMAIL THIS PAGE TO A FRIEND

ARHGAP4

Rho GTPase activating protein 4

51 Gene Product Result for
Synonyms: C1 RGC1 RhoGAP4 SrGAP4 p115
UniProtKB ID: P98171, Q14144, Q86UY3
Gene ID:
Human(393) Summary: This gene encodes a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins belonging to the RAS superfamily. The protein encoded by the orthologous gene in rat is localized to the Golgi complex and can redistribute to microtubules. The rat protein stimulates the activity of some Rho GTPases in vitro. Genomic deletions of this gene and a neighboring gene have been found in patients with nephrogenic diabetes insipidus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(171207) Rho GTPase activating protein 4
Rat(246249) Rho GTPase activating protein 4
naked mole-rat(101725190) Rho GTPase activating protein 4
domestic guinea pig(100735978) Rho GTPase activating protein 4
sheep(101107503) Rho GTPase activating protein 4
dog(492245) Rho GTPase activating protein 4
Horse(100057993) Rho GTPase activating protein 4
cow(100124430) Rho GTPase activating protein 4
domestic cat(101089250) Rho GTPase activating protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001666 Rosetta Predictions human pricing
NM_144740 Rosetta Predictions rat pricing
NM_138630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061641 predicted 1071
2 SASI_Hs02_00332293 predicted 1241
3 SASI_Hs02_00332294 predicted 728
4 SASI_Hs02_00332295 predicted 1075
5 SASI_Hs01_00061642 predicted 325
6 SASI_Hs01_00061643 predicted 2618
7 SASI_Hs01_00061644 predicted 2649
8 SASI_Hs01_00061645 predicted 1470
9 SASI_Hs02_00332296 predicted 1464
10 SASI_Hs01_00061647 predicted 758
11 SASI_Hs01_00061646 predicted 2073
12 SASI_Hs01_00061648 predicted 682
13 SASI_Hs01_00061649 predicted 1627
14 SASI_Hs01_00061650 predicted 2728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114669 predicted 2256
2 SASI_Rn01_00114670 predicted 920
3 SASI_Rn01_00114671 predicted 292
4 SASI_Rn01_00114672 predicted 534
5 SASI_Rn01_00114673 predicted 660
6 SASI_Rn01_00114674 predicted 2188
7 SASI_Rn01_00114675 predicted 2738
8 SASI_Rn01_00114676 predicted 628
9 SASI_Rn01_00114677 predicted 1454
10 SASI_Rn01_00114678 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192658 predicted 2894
2 SASI_Mm01_00192659 predicted 200
3 SASI_Mm01_00192660 predicted 1611
4 SASI_Mm01_00192661 predicted 1728
5 SASI_Mm01_00192662 predicted 1336
6 SASI_Mm01_00192663 predicted 1338
7 SASI_Mm01_00192664 predicted 1333
8 SASI_Mm01_00192665 predicted 1187
9 SASI_Mm01_00192666 predicted 1607
10 SASI_Mm01_00192667 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138630
ARHGAP4 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138630.1-2985s1c1
Sequence:CCGGGCTCCTCTTATGCCTTTGCTTCTCGAGAAGCAAAGGCATAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-721s1c1
Sequence:CCGGGCCAAGTACTTGGAGCATAAACTCGAGTTTATGCTCCAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1516s1c1
Sequence:CCGGCATCCTAGATTCCAGTATAATCTCGAGATTATACTGGAATCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-806s1c1
Sequence:CCGGGCAACTACTACTTACACGATACTCGAGTATCGTGTAAGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1926s1c1
Sequence:CCGGCCTACGCTATCTCTTCACCTTCTCGAGAAGGTGAAGAGATAGCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138630
ARHGAP4 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138630.1-2985s1c1
Sequence:CCGGGCTCCTCTTATGCCTTTGCTTCTCGAGAAGCAAAGGCATAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-721s1c1
Sequence:CCGGGCCAAGTACTTGGAGCATAAACTCGAGTTTATGCTCCAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1516s1c1
Sequence:CCGGCATCCTAGATTCCAGTATAATCTCGAGATTATACTGGAATCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-806s1c1
Sequence:CCGGGCAACTACTACTTACACGATACTCGAGTATCGTGTAAGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1926s1c1
Sequence:CCGGCCTACGCTATCTCTTCACCTTCTCGAGAAGGTGAAGAGATAGCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138630
ARHGAP4 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138630.1-2985s1c1
Sequence:CCGGGCTCCTCTTATGCCTTTGCTTCTCGAGAAGCAAAGGCATAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-721s1c1
Sequence:CCGGGCCAAGTACTTGGAGCATAAACTCGAGTTTATGCTCCAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1516s1c1
Sequence:CCGGCATCCTAGATTCCAGTATAATCTCGAGATTATACTGGAATCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-806s1c1
Sequence:CCGGGCAACTACTACTTACACGATACTCGAGTATCGTGTAAGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138630.1-1926s1c1
Sequence:CCGGCCTACGCTATCTCTTCACCTTCTCGAGAAGGTGAAGAGATAGCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001666
ARHGAP4 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-730s1c1
Sequence:CCGGGCCAAGTTCATGGAGCACAAACTCGAGTTTGTGCTCCATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-804s1c1
Sequence:CCGGCGCTGCTGTCAGTAACTACTACTCGAGTAGTAGTTACTGACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1350s1c1
Sequence:CCGGCGAAACCTTCTACCTCACGAACTCGAGTTCGTGAGGTAGAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1623s1c1
Sequence:CCGGCATTCGCTTCATCAACCTCAACTCGAGTTGAGGTTGATGAAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-2661s1c1
Sequence:CCGGGAACATGGACTCTGTGTTTAACTCGAGTTAAACACAGAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-105s21c1
Sequence:CCGGAGTATGAGACGCAAGTCAAAGCTCGAGCTTTGACTTGCGTCTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-1554s21c1
Sequence:CCGGAGTATAACCAGAGACTCTTTGCTCGAGCAAAGAGTCTCTGGTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001666
ARHGAP4 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-730s1c1
Sequence:CCGGGCCAAGTTCATGGAGCACAAACTCGAGTTTGTGCTCCATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-804s1c1
Sequence:CCGGCGCTGCTGTCAGTAACTACTACTCGAGTAGTAGTTACTGACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1350s1c1
Sequence:CCGGCGAAACCTTCTACCTCACGAACTCGAGTTCGTGAGGTAGAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1623s1c1
Sequence:CCGGCATTCGCTTCATCAACCTCAACTCGAGTTGAGGTTGATGAAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-2661s1c1
Sequence:CCGGGAACATGGACTCTGTGTTTAACTCGAGTTAAACACAGAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-105s21c1
Sequence:CCGGAGTATGAGACGCAAGTCAAAGCTCGAGCTTTGACTTGCGTCTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-1554s21c1
Sequence:CCGGAGTATAACCAGAGACTCTTTGCTCGAGCAAAGAGTCTCTGGTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001666
ARHGAP4 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-730s1c1
Sequence:CCGGGCCAAGTTCATGGAGCACAAACTCGAGTTTGTGCTCCATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-804s1c1
Sequence:CCGGCGCTGCTGTCAGTAACTACTACTCGAGTAGTAGTTACTGACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1350s1c1
Sequence:CCGGCGAAACCTTCTACCTCACGAACTCGAGTTCGTGAGGTAGAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-1623s1c1
Sequence:CCGGCATTCGCTTCATCAACCTCAACTCGAGTTGAGGTTGATGAAGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001666.2-2661s1c1
Sequence:CCGGGAACATGGACTCTGTGTTTAACTCGAGTTAAACACAGAGTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-105s21c1
Sequence:CCGGAGTATGAGACGCAAGTCAAAGCTCGAGCTTTGACTTGCGTCTCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001666.4-1554s21c1
Sequence:CCGGAGTATAACCAGAGACTCTTTGCTCGAGCAAAGAGTCTCTGGTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks