EMAIL THIS PAGE TO A FRIEND

ARHGAP5

Rho GTPase activating protein 5

217 Gene Product Result for
Synonyms: GFI2 RhoGAP5 p190-B p190BRhoGAP
Gene ID:
Human(394) Summary: Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11855) Rho GTPase activating protein 5
Rat(299012) Rho GTPase activating protein 5
Zebrafish(795752) Rho GTPase activating protein 5
dog(490642) Rho GTPase activating protein 5
Horse(100056199) Rho GTPase activating protein 5
cow(788978) Rho GTPase activating protein 5
domestic cat(101088248) Rho GTPase activating protein 5
chicken(428883) Rho GTPase activating protein 5
naked mole-rat(101697068) Rho GTPase activating protein 5
domestic guinea pig(100715491) Rho GTPase activating protein 5
sheep(101116866) Rho GTPase activating protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030055 Rosetta Predictions human pricing
NM_001173 Rosetta Predictions human pricing
NM_001047869 Rosetta Predictions rat pricing
NM_009706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188461 predicted 1886
2 SASI_Hs01_00188462 predicted 2246
3 SASI_Hs01_00188463 predicted 974
4 SASI_Hs01_00188464 predicted 1562
5 SASI_Hs02_00307637 predicted 2612
6 SASI_Hs01_00188465 predicted 984
7 SASI_Hs01_00188466 predicted 2047
8 SASI_Hs01_00188467 predicted 1000
9 SASI_Hs01_00188468 predicted 2658
10 SASI_Hs01_00188469 predicted 2513
11 SASI_Hs01_00188470 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026127 predicted 1879
2 SASI_Hs01_00026128 predicted 2251
3 SASI_Hs01_00026129 predicted 967
4 SASI_Hs01_00026130 predicted 1553
5 SASI_Hs02_00331299 predicted 2614
6 SASI_Hs01_00026131 predicted 987
7 SASI_Hs01_00026132 predicted 2039
8 SASI_Hs01_00026133 predicted 997
9 SASI_Hs01_00026134 predicted 2664
10 SASI_Hs01_00026135 predicted 2513
11 SASI_Hs01_00026136 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206357 predicted 1563
2 SASI_Rn02_00206358 predicted 447
3 SASI_Rn02_00206359 predicted 2195
4 SASI_Rn02_00206360 predicted 3178
5 SASI_Rn02_00206361 predicted 672
6 SASI_Rn02_00206362 predicted 2473
7 SASI_Rn02_00206363 predicted 3303
8 SASI_Rn02_00206364 predicted 1235
9 SASI_Rn02_00206365 predicted 573
10 SASI_Rn02_00206366 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316847 predicted 3291
2 SASI_Mm01_00081621 predicted 839
3 SASI_Mm01_00081622 predicted 2651
4 SASI_Mm01_00081623 predicted 2272
5 SASI_Mm01_00081624 predicted 197
6 SASI_Mm02_00316848 predicted 4574
7 SASI_Mm01_00081625 predicted 2235
8 SASI_Mm02_00316849 predicted 854
9 SASI_Mm01_00081626 predicted 750
10 SASI_Mm01_00081628 predicted 282
11 SASI_Mm01_00081627 predicted 2376
12 SASI_Mm01_00081629 predicted 1893
13 SASI_Mm01_00081630 predicted 1932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009706
VALIDATED
ARHGAP5 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-3689s1c1
Sequence:CCGGCCCACAAAGTAAAGGAAGATACTCGAGTATCTTCCTTTACTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-685s1c1
Sequence:CCGGGCACGATTTAATGTCAACATTCTCGAGAATGTTGACATTAAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009706.1-4021s1c1
Sequence:CCGGCCTGATCCTTTGATTCCATATCTCGAGATATGGAATCAAAGGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2917s1c1
Sequence:CCGGCCCTATAACAACTACCCTGATCTCGAGATCAGGGTAGTTGTTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2238s1c1
Sequence:CCGGGCAAGCTCTAAGAGGAGTATTCTCGAGAATACTCCTCTTAGAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4868s21c1
Sequence:CCGGAGCATGACTGGAGAGGTTTAACTCGAGTTAAACCTCTCCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2373s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3510s21c1
Sequence:CCGGTGATAGTCAGAATCGAATTATCTCGAGATAATTCGATTCTGACTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2707s21c1
Sequence:CCGGGAACTGGTTCATGGGTATATACTCGAGTATATACCCATGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-4660s21c1
Sequence:CCGGACAGATCCTCTTGGTATTATACTCGAGTATAATACCAAGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4948s21c1
Sequence:CCGGATTGCAATCAGTATATCATTCCTCGAGGAATGATATACTGATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-752s21c1
Sequence:CCGGTGATAATAGCAGCAACTAAATCTCGAGATTTAGTTGCTGCTATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3256s21c1
Sequence:CCGGGATCATGAACGTAACCATAAACTCGAGTTTATGGTTACGTTCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009706
VALIDATED
ARHGAP5 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-3689s1c1
Sequence:CCGGCCCACAAAGTAAAGGAAGATACTCGAGTATCTTCCTTTACTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-685s1c1
Sequence:CCGGGCACGATTTAATGTCAACATTCTCGAGAATGTTGACATTAAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009706.1-4021s1c1
Sequence:CCGGCCTGATCCTTTGATTCCATATCTCGAGATATGGAATCAAAGGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2917s1c1
Sequence:CCGGCCCTATAACAACTACCCTGATCTCGAGATCAGGGTAGTTGTTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2238s1c1
Sequence:CCGGGCAAGCTCTAAGAGGAGTATTCTCGAGAATACTCCTCTTAGAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4868s21c1
Sequence:CCGGAGCATGACTGGAGAGGTTTAACTCGAGTTAAACCTCTCCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2373s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3510s21c1
Sequence:CCGGTGATAGTCAGAATCGAATTATCTCGAGATAATTCGATTCTGACTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2707s21c1
Sequence:CCGGGAACTGGTTCATGGGTATATACTCGAGTATATACCCATGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-4660s21c1
Sequence:CCGGACAGATCCTCTTGGTATTATACTCGAGTATAATACCAAGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4948s21c1
Sequence:CCGGATTGCAATCAGTATATCATTCCTCGAGGAATGATATACTGATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-752s21c1
Sequence:CCGGTGATAATAGCAGCAACTAAATCTCGAGATTTAGTTGCTGCTATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3256s21c1
Sequence:CCGGGATCATGAACGTAACCATAAACTCGAGTTTATGGTTACGTTCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009706
VALIDATED
ARHGAP5 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-3689s1c1
Sequence:CCGGCCCACAAAGTAAAGGAAGATACTCGAGTATCTTCCTTTACTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-685s1c1
Sequence:CCGGGCACGATTTAATGTCAACATTCTCGAGAATGTTGACATTAAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009706.1-4021s1c1
Sequence:CCGGCCTGATCCTTTGATTCCATATCTCGAGATATGGAATCAAAGGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2917s1c1
Sequence:CCGGCCCTATAACAACTACCCTGATCTCGAGATCAGGGTAGTTGTTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009706.1-2238s1c1
Sequence:CCGGGCAAGCTCTAAGAGGAGTATTCTCGAGAATACTCCTCTTAGAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4868s21c1
Sequence:CCGGAGCATGACTGGAGAGGTTTAACTCGAGTTAAACCTCTCCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2373s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3510s21c1
Sequence:CCGGTGATAGTCAGAATCGAATTATCTCGAGATAATTCGATTCTGACTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-2707s21c1
Sequence:CCGGGAACTGGTTCATGGGTATATACTCGAGTATATACCCATGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-4660s21c1
Sequence:CCGGACAGATCCTCTTGGTATTATACTCGAGTATAATACCAAGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-4948s21c1
Sequence:CCGGATTGCAATCAGTATATCATTCCTCGAGGAATGATATACTGATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009706.2-752s21c1
Sequence:CCGGTGATAATAGCAGCAACTAAATCTCGAGATTTAGTTGCTGCTATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009706.2-3256s21c1
Sequence:CCGGGATCATGAACGTAACCATAAACTCGAGTTTATGGTTACGTTCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001173
ARHGAP5 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001173.1-4811s1c1
Sequence:CCGGTGATTGCAAACAGGCTGGATTCTCGAGAATCCAGCCTGTTTGCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3175s1c1
Sequence:CCGGCCCATCAAAGTGAAGATGTTTCTCGAGAAACATCTTCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-4564s1c1
Sequence:CCGGCGATGGAGTTTCTGTCTACTACTCGAGTAGTAGACAGAAACTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3222s1c1
Sequence:CCGGCCCTATAATAACTACCCTGATCTCGAGATCAGGGTAGTTATTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-332s1c1
Sequence:CCGGCCCATCCTATACCATCAGTATCTCGAGATACTGATGGTATAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-918s21c1
Sequence:CCGGTGATGAATGCGTGGATCATTACTCGAGTAATGATCCACGCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-3589s21c1
Sequence:CCGGGCGGAACCCATTGATACAATTCTCGAGAATTGTATCAATGGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5228s21c1
Sequence:CCGGGTGCTAATTTGGGCAACTTAACTCGAGTTAAGTTGCCCAAATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2517s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2075s21c1
Sequence:CCGGATCACGATAGTACCAATATAGCTCGAGCTATATTGGTACTATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-642s21c1
Sequence:CCGGTACGAATTTGCAACCATATATCTCGAGATATATGGTTGCAAATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5104s21c1
Sequence:CCGGGCAATTTCTGTCACCTTATATCTCGAGATATAAGGTGACAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-4198s21c1
Sequence:CCGGTACCGTGTCAGCGGGAATAAACTCGAGTTTATTCCCGCTGACACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001173
ARHGAP5 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001173.1-4811s1c1
Sequence:CCGGTGATTGCAAACAGGCTGGATTCTCGAGAATCCAGCCTGTTTGCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3175s1c1
Sequence:CCGGCCCATCAAAGTGAAGATGTTTCTCGAGAAACATCTTCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-4564s1c1
Sequence:CCGGCGATGGAGTTTCTGTCTACTACTCGAGTAGTAGACAGAAACTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3222s1c1
Sequence:CCGGCCCTATAATAACTACCCTGATCTCGAGATCAGGGTAGTTATTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-332s1c1
Sequence:CCGGCCCATCCTATACCATCAGTATCTCGAGATACTGATGGTATAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-918s21c1
Sequence:CCGGTGATGAATGCGTGGATCATTACTCGAGTAATGATCCACGCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-3589s21c1
Sequence:CCGGGCGGAACCCATTGATACAATTCTCGAGAATTGTATCAATGGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5228s21c1
Sequence:CCGGGTGCTAATTTGGGCAACTTAACTCGAGTTAAGTTGCCCAAATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2517s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2075s21c1
Sequence:CCGGATCACGATAGTACCAATATAGCTCGAGCTATATTGGTACTATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-642s21c1
Sequence:CCGGTACGAATTTGCAACCATATATCTCGAGATATATGGTTGCAAATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5104s21c1
Sequence:CCGGGCAATTTCTGTCACCTTATATCTCGAGATATAAGGTGACAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-4198s21c1
Sequence:CCGGTACCGTGTCAGCGGGAATAAACTCGAGTTTATTCCCGCTGACACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001173
ARHGAP5 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001173.1-4811s1c1
Sequence:CCGGTGATTGCAAACAGGCTGGATTCTCGAGAATCCAGCCTGTTTGCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3175s1c1
Sequence:CCGGCCCATCAAAGTGAAGATGTTTCTCGAGAAACATCTTCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-4564s1c1
Sequence:CCGGCGATGGAGTTTCTGTCTACTACTCGAGTAGTAGACAGAAACTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-3222s1c1
Sequence:CCGGCCCTATAATAACTACCCTGATCTCGAGATCAGGGTAGTTATTATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001173.1-332s1c1
Sequence:CCGGCCCATCCTATACCATCAGTATCTCGAGATACTGATGGTATAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-918s21c1
Sequence:CCGGTGATGAATGCGTGGATCATTACTCGAGTAATGATCCACGCATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-3589s21c1
Sequence:CCGGGCGGAACCCATTGATACAATTCTCGAGAATTGTATCAATGGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5228s21c1
Sequence:CCGGGTGCTAATTTGGGCAACTTAACTCGAGTTAAGTTGCCCAAATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2517s21c1
Sequence:CCGGTGGTACATATCCTCGTAAATTCTCGAGAATTTACGAGGATATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-2075s21c1
Sequence:CCGGATCACGATAGTACCAATATAGCTCGAGCTATATTGGTACTATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-642s21c1
Sequence:CCGGTACGAATTTGCAACCATATATCTCGAGATATATGGTTGCAAATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173.2-5104s21c1
Sequence:CCGGGCAATTTCTGTCACCTTATATCTCGAGATATAAGGTGACAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173.2-4198s21c1
Sequence:CCGGTACCGTGTCAGCGGGAATAAACTCGAGTTTATTCCCGCTGACACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks