EMAIL THIS PAGE TO A FRIEND

ARHGAP6

Rho GTPase activating protein 6

194 Gene Product Result for
Synonyms: RHOGAP6 RHOGAPX-1
UniProtKB ID: O43182, B2RWQ0, O43437, Q9P1B3, Q9UK81, Q9UK82
Gene ID:
Human(395) Summary: This gene encodes a member of the rhoGAP family of proteins which play a role in the regulation of actin polymerization at the plasma membrane during several cellular processes. This protein is thought to have two independent functions, one as a GTPase-activating protein with specificity for RhoA, and another as a cytoskeletal protein that promotes actin remodeling. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11856) Rho GTPase activating protein 6
Rat(100363276) Rho GTPase activating protein 6
chicken(418642) Rho GTPase activating protein 6
dog(491738) Rho GTPase activating protein 6
cow(100140016) Rho GTPase activating protein 6
domestic cat(101088551) Rho GTPase activating protein 6
sheep(101118504) Rho GTPase activating protein 6
domestic guinea pig(100714168) Rho GTPase activating protein 6
naked mole-rat(101699830) Rho GTPase activating protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001174 Rosetta Predictions human pricing
NM_006125 Rosetta Predictions human pricing
NM_013422 Rosetta Predictions human pricing
NM_013423 Rosetta Predictions human pricing
NM_013427 Rosetta Predictions human pricing
NM_009707 Rosetta Predictions mouse pricing
NM_178754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164156 predicted 2428
2 SASI_Hs01_00164157 predicted 2049
3 SASI_Hs01_00164158 predicted 2089
4 SASI_Hs01_00164159 predicted 2161
5 SASI_Hs01_00164160 predicted 2473
6 SASI_Hs01_00164161 predicted 2066
7 SASI_Hs01_00164162 predicted 1804
8 SASI_Hs01_00164163 predicted 2653
9 SASI_Hs01_00164164 predicted 2303
10 SASI_Hs01_00164165 predicted 2634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340954 predicted 2726
2 SASI_Hs01_00228084 predicted 2324
3 SASI_Hs02_00340955 predicted 1845
4 SASI_Hs02_00340956 predicted 2625
5 SASI_Hs02_00340957 predicted 2776
6 SASI_Hs01_00228086 predicted 1980
7 SASI_Hs01_00228087 predicted 2058
8 SASI_Hs01_00228092 predicted 2202
9 SASI_Hs02_00340958 predicted 1778
10 SASI_Hs02_00340959 predicted 1967
11 SASI_Hs01_00228085 predicted 1952
12 SASI_Hs01_00228088 predicted 2381
13 SASI_Hs01_00228089 predicted 1978
14 SASI_Hs01_00228090 predicted 1707
15 SASI_Hs01_00228091 predicted 2553
16 SASI_Hs01_00228093 predicted 2536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057303 predicted 2432
2 SASI_Hs01_00057304 predicted 2055
3 SASI_Hs01_00057305 predicted 2089
4 SASI_Hs01_00057306 predicted 2164
5 SASI_Hs01_00057307 predicted 2479
6 SASI_Hs01_00057308 predicted 2067
7 SASI_Hs01_00057309 predicted 1805
8 SASI_Hs01_00057310 predicted 2644
9 SASI_Hs01_00057311 predicted 2308
10 SASI_Hs01_00057312 predicted 2632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344805 predicted 1558
2 SASI_Hs01_00109652 predicted 1159
3 SASI_Hs02_00344806 predicted 678
4 SASI_Hs02_00344807 predicted 1451
5 SASI_Hs02_00344808 predicted 1609
6 SASI_Hs01_00109654 predicted 817
7 SASI_Hs01_00109655 predicted 886
8 SASI_Hs01_00109660 predicted 1032
9 SASI_Hs02_00344809 predicted 613
10 SASI_Hs02_00344810 predicted 793
11 SASI_Hs01_00109653 predicted 781
12 SASI_Hs01_00109656 predicted 1209
13 SASI_Hs01_00109657 predicted 804
14 SASI_Hs01_00109658 predicted 531
15 SASI_Hs01_00109659 predicted 1386
16 SASI_Hs01_00109661 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344811 predicted 2734
2 SASI_Hs01_00225424 predicted 2332
3 SASI_Hs02_00344812 predicted 1850
4 SASI_Hs02_00344813 predicted 2626
5 SASI_Hs02_00344814 predicted 2779
6 SASI_Hs01_00225426 predicted 1981
7 SASI_Hs01_00225427 predicted 2057
8 SASI_Hs01_00225432 predicted 2209
9 SASI_Hs02_00344815 predicted 1784
10 SASI_Hs02_00344816 predicted 1963
11 SASI_Hs01_00225425 predicted 1952
12 SASI_Hs01_00225428 predicted 2381
13 SASI_Hs01_00225429 predicted 1979
14 SASI_Hs01_00225430 predicted 1700
15 SASI_Hs01_00225431 predicted 2554
16 SASI_Hs01_00225433 predicted 2538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151911 predicted 2781
2 SASI_Mm01_00151912 predicted 1983
3 SASI_Mm01_00151914 predicted 3694
4 SASI_Mm01_00151915 predicted 2875
5 SASI_Mm02_00316850 predicted 2571
6 SASI_Mm01_00151916 predicted 2734
7 SASI_Mm01_00151918 predicted 2895
8 SASI_Mm01_00151919 predicted 2097
9 SASI_Mm02_00316851 predicted 3340
10 SASI_Mm01_00151920 predicted 2955
11 SASI_Mm01_00151913 predicted 2582
12 SASI_Mm01_00151917 predicted 2532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160547 predicted 1300
2 SASI_Mm01_00160548 predicted 512
3 SASI_Mm01_00160550 predicted 2216
4 SASI_Mm01_00160551 predicted 1406
5 SASI_Mm02_00349296 predicted 1094
6 SASI_Mm01_00160552 predicted 1265
7 SASI_Mm01_00160554 predicted 1415
8 SASI_Mm01_00160555 predicted 621
9 SASI_Mm02_00349297 predicted 1862
10 SASI_Mm01_00160556 predicted 1489
11 SASI_Mm01_00160549 predicted 1109
12 SASI_Mm01_00160553 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006125
ARHGAP6 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1738s21c1
Sequence:GTACCGGGCGAATGACAGGGCCTATAAACTCGAGTTTATAGGCCCTGTCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006125.2-3399s21c1
Sequence:GTACCGGGTCTGAGGTGCCACCCAATTACTCGAGTAATTGGGTGGCACCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-2378s21c1
Sequence:GTACCGGGCACCTTGCAGCTCCTCATATCTCGAGATATGAGGAGCTGCAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1973s21c1
Sequence:GTACCGGTCACCGATCTTGATGACAATCCTCGAGGATTGTCATCAAGATCGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3151s1c1
Sequence:CCGGCCCTTATTTGATGTTTCTGTACTCGAGTACAGAAACATCAAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2773s1c1
Sequence:CCGGCCAATCATCAAGCCCTGACATCTCGAGATGTCAGGGCTTGATGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3003s1c1
Sequence:CCGGCGTCGTCAAAGTCAAGGGAAACTCGAGTTTCCCTTGACTTTGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-1611s1c1
Sequence:CCGGCCATTCCCAAAGATGGACAAACTCGAGTTTGTCCATCTTTGGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2471s1c1
Sequence:CCGGGCCGATGACAACATCAGCAAACTCGAGTTTGCTGATGTTGTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006125
ARHGAP6 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1738s21c1
Sequence:GTACCGGGCGAATGACAGGGCCTATAAACTCGAGTTTATAGGCCCTGTCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006125.2-3399s21c1
Sequence:GTACCGGGTCTGAGGTGCCACCCAATTACTCGAGTAATTGGGTGGCACCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-2378s21c1
Sequence:GTACCGGGCACCTTGCAGCTCCTCATATCTCGAGATATGAGGAGCTGCAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1973s21c1
Sequence:GTACCGGTCACCGATCTTGATGACAATCCTCGAGGATTGTCATCAAGATCGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3151s1c1
Sequence:CCGGCCCTTATTTGATGTTTCTGTACTCGAGTACAGAAACATCAAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2773s1c1
Sequence:CCGGCCAATCATCAAGCCCTGACATCTCGAGATGTCAGGGCTTGATGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3003s1c1
Sequence:CCGGCGTCGTCAAAGTCAAGGGAAACTCGAGTTTCCCTTGACTTTGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-1611s1c1
Sequence:CCGGCCATTCCCAAAGATGGACAAACTCGAGTTTGTCCATCTTTGGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2471s1c1
Sequence:CCGGGCCGATGACAACATCAGCAAACTCGAGTTTGCTGATGTTGTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006125
ARHGAP6 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1738s21c1
Sequence:GTACCGGGCGAATGACAGGGCCTATAAACTCGAGTTTATAGGCCCTGTCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006125.2-3399s21c1
Sequence:GTACCGGGTCTGAGGTGCCACCCAATTACTCGAGTAATTGGGTGGCACCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-2378s21c1
Sequence:GTACCGGGCACCTTGCAGCTCCTCATATCTCGAGATATGAGGAGCTGCAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006125.2-1973s21c1
Sequence:GTACCGGTCACCGATCTTGATGACAATCCTCGAGGATTGTCATCAAGATCGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3151s1c1
Sequence:CCGGCCCTTATTTGATGTTTCTGTACTCGAGTACAGAAACATCAAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2773s1c1
Sequence:CCGGCCAATCATCAAGCCCTGACATCTCGAGATGTCAGGGCTTGATGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-3003s1c1
Sequence:CCGGCGTCGTCAAAGTCAAGGGAAACTCGAGTTTCCCTTGACTTTGACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-1611s1c1
Sequence:CCGGCCATTCCCAAAGATGGACAAACTCGAGTTTGTCCATCTTTGGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006125.1-2471s1c1
Sequence:CCGGGCCGATGACAACATCAGCAAACTCGAGTTTGCTGATGTTGTCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009707
VALIDATED
ARHGAP6 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009707.3-1989s21c1
Sequence:CCGGTGCTAATGACCGGGCATATAACTCGAGTTATATGCCCGGTCATTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-3506s21c1
Sequence:CCGGACAGTGGCACTCAGGTAATTCCTCGAGGAATTACCTGAGTGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009707.3-4362s21c1
Sequence:CCGGGAAACTCTTGCTTCGTTATAGCTCGAGCTATAACGAAGCAAGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-2327s21c1
Sequence:CCGGAGCTGAGTCTGAATCCTATTTCTCGAGAAATAGGATTCAGACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009707.1-3645s1c1
Sequence:CCGGCCTGCCATTTATGGTAAGATTCTCGAGAATCTTACCATAAATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1650s1c1
Sequence:CCGGCCTTGTTAAAGGAGTTCCTTACTCGAGTAAGGAACTCCTTTAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1649s1c1
Sequence:CCGGGCCTTGTTAAAGGAGTTCCTTCTCGAGAAGGAACTCCTTTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1121s1c1
Sequence:CCGGCGGGCATATAAACTGAAGCAACTCGAGTTGCTTCAGTTTATATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009707.1-2162s1c1
Sequence:CCGGCCTGACATACTTCAGACGGAACTCGAGTTCCGTCTGAAGTATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009707
VALIDATED
ARHGAP6 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009707.3-1989s21c1
Sequence:CCGGTGCTAATGACCGGGCATATAACTCGAGTTATATGCCCGGTCATTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-3506s21c1
Sequence:CCGGACAGTGGCACTCAGGTAATTCCTCGAGGAATTACCTGAGTGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009707.3-4362s21c1
Sequence:CCGGGAAACTCTTGCTTCGTTATAGCTCGAGCTATAACGAAGCAAGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-2327s21c1
Sequence:CCGGAGCTGAGTCTGAATCCTATTTCTCGAGAAATAGGATTCAGACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009707.1-3645s1c1
Sequence:CCGGCCTGCCATTTATGGTAAGATTCTCGAGAATCTTACCATAAATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1650s1c1
Sequence:CCGGCCTTGTTAAAGGAGTTCCTTACTCGAGTAAGGAACTCCTTTAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1649s1c1
Sequence:CCGGGCCTTGTTAAAGGAGTTCCTTCTCGAGAAGGAACTCCTTTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1121s1c1
Sequence:CCGGCGGGCATATAAACTGAAGCAACTCGAGTTGCTTCAGTTTATATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009707.1-2162s1c1
Sequence:CCGGCCTGACATACTTCAGACGGAACTCGAGTTCCGTCTGAAGTATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009707
VALIDATED
ARHGAP6 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009707.3-1989s21c1
Sequence:CCGGTGCTAATGACCGGGCATATAACTCGAGTTATATGCCCGGTCATTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-3506s21c1
Sequence:CCGGACAGTGGCACTCAGGTAATTCCTCGAGGAATTACCTGAGTGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009707.3-4362s21c1
Sequence:CCGGGAAACTCTTGCTTCGTTATAGCTCGAGCTATAACGAAGCAAGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009707.3-2327s21c1
Sequence:CCGGAGCTGAGTCTGAATCCTATTTCTCGAGAAATAGGATTCAGACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009707.1-3645s1c1
Sequence:CCGGCCTGCCATTTATGGTAAGATTCTCGAGAATCTTACCATAAATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1650s1c1
Sequence:CCGGCCTTGTTAAAGGAGTTCCTTACTCGAGTAAGGAACTCCTTTAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1649s1c1
Sequence:CCGGGCCTTGTTAAAGGAGTTCCTTCTCGAGAAGGAACTCCTTTAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009707.1-1121s1c1
Sequence:CCGGCGGGCATATAAACTGAAGCAACTCGAGTTGCTTCAGTTTATATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009707.1-2162s1c1
Sequence:CCGGCCTGACATACTTCAGACGGAACTCGAGTTCCGTCTGAAGTATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)