EMAIL THIS PAGE TO A FRIEND

ARHGAP8

Rho GTPase activating protein 8

57 Gene Product Result for
Synonyms: BPGAP1 PP610
Gene ID:
Human(23779) Summary: This gene encodes a member of the RHOGAP family. GAP (GTPase-activating) family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. GAP proteins alternate between an active (GTP-bound) and inactive (GDP-bound) state based on the GTP:GDP ratio in the cell. This family member is a multidomain protein that functions to promote Erk activation and cell motility. Alternative splicing results in multiple transcript variants. Read-through transcripts from the upstream proline rich 5, renal (PRR5) gene into this gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Mouse(73167) Rho GTPase activating protein 8
Rat(300115) Rho GTPase activating protein 8
naked mole-rat(101703941) Rho GTPase activating protein 8
domestic guinea pig(100723032) Rho GTPase activating protein 8
chicken(418239) Rho GTPase activating protein 8
dog(100533462) Rho GTPase activating protein 8
domestic cat(101094114) Rho GTPase activating protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017526 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017526 Rosetta Predictions human pricing
NM_181335 Rosetta Predictions human pricing
NM_001004242 Rosetta Predictions rat pricing
NM_028455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306787 predicted 1345
2 SASI_Hs01_00097238 predicted 822
3 SASI_Hs01_00097239 predicted 1262
4 SASI_Hs01_00097240 predicted 946
5 SASI_Hs01_00097241 predicted 1019
6 SASI_Hs01_00097242 predicted 983
7 SASI_Hs01_00097243 predicted 1341
8 SASI_Hs01_00097244 predicted 809
9 SASI_Hs01_00097245 predicted 959
10 SASI_Hs01_00097246 predicted 800
11 SASI_Hs01_00097247 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369993 predicted 1249
2 SASI_Hs01_00029108 predicted 728
3 SASI_Hs01_00029109 predicted 1167
4 SASI_Hs01_00029110 predicted 857
5 SASI_Hs01_00029111 predicted 925
6 SASI_Hs01_00029112 predicted 893
7 SASI_Hs01_00029113 predicted 1247
8 SASI_Hs01_00029114 predicted 720
9 SASI_Hs01_00029115 predicted 871
10 SASI_Hs01_00029116 predicted 708
11 SASI_Hs01_00029117 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060772 predicted 695
2 SASI_Rn01_00060773 predicted 423
3 SASI_Rn01_00060774 predicted 871
4 SASI_Rn01_00060775 predicted 1126
5 SASI_Rn01_00060776 predicted 1140
6 SASI_Rn01_00060777 predicted 841
7 SASI_Rn01_00060778 predicted 303
8 SASI_Rn01_00060779 predicted 1283
9 SASI_Rn01_00060780 predicted 1196
10 SASI_Rn01_00060781 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333899 predicted 273
2 SASI_Mm01_00104602 predicted 830
3 SASI_Mm01_00104603 predicted 1065
4 SASI_Mm01_00104604 predicted 795
5 SASI_Mm02_00333900 predicted 1165
6 SASI_Mm01_00104605 predicted 265
7 SASI_Mm01_00104606 predicted 1162
8 SASI_Mm01_00104607 predicted 814
9 SASI_Mm01_00104608 predicted 282
10 SASI_Mm01_00104609 predicted 1254
11 SASI_Mm01_00104610 predicted 1103
12 SASI_Mm01_00104611 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028455
ARHGAP8 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-286s1c1
Sequence:CCGGCGACTATACTATTGTCTACTTCTCGAGAAGTAGACAATAGTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-283s1c1
Sequence:CCGGGAACGACTATACTATTGTCTACTCGAGTAGACAATAGTATAGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-1284s1c1
Sequence:CCGGGCCCTGTTACCAAAGAATTTACTCGAGTAAATTCTTTGGTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-836s1c1
Sequence:CCGGCCCGTGAACTTTGATGATTATCTCGAGATAATCATCAAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-875s1c1
Sequence:CCGGGCCGTGATCCTGAAGACATTTCTCGAGAAATGTCTTCAGGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028455
ARHGAP8 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-286s1c1
Sequence:CCGGCGACTATACTATTGTCTACTTCTCGAGAAGTAGACAATAGTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-283s1c1
Sequence:CCGGGAACGACTATACTATTGTCTACTCGAGTAGACAATAGTATAGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-1284s1c1
Sequence:CCGGGCCCTGTTACCAAAGAATTTACTCGAGTAAATTCTTTGGTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-836s1c1
Sequence:CCGGCCCGTGAACTTTGATGATTATCTCGAGATAATCATCAAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-875s1c1
Sequence:CCGGGCCGTGATCCTGAAGACATTTCTCGAGAAATGTCTTCAGGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028455
ARHGAP8 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-286s1c1
Sequence:CCGGCGACTATACTATTGTCTACTTCTCGAGAAGTAGACAATAGTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-283s1c1
Sequence:CCGGGAACGACTATACTATTGTCTACTCGAGTAGACAATAGTATAGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-1284s1c1
Sequence:CCGGGCCCTGTTACCAAAGAATTTACTCGAGTAAATTCTTTGGTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-836s1c1
Sequence:CCGGCCCGTGAACTTTGATGATTATCTCGAGATAATCATCAAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028455.1-875s1c1
Sequence:CCGGGCCGTGATCCTGAAGACATTTCTCGAGAAATGTCTTCAGGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017526
VALIDATED
ARHGAP8 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-664s21c1
Sequence:CCGGGAGCTCCACGAACACCTTAAACTCGAGTTTAAGGTGTTCGTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-611s21c1
Sequence:CCGGCCCTCATCAGTCACAAGTTTGCTCGAGCAAACTTGTGACTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-811s21c1
Sequence:CCGGTTTGGCGTCAGTCTGCAATACCTCGAGGTATTGCAGACTGACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-1538s21c1
Sequence:CCGGGTTGCGAACACTCTGTATATTCTCGAGAATATACAGAGTGTTCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-333s21c1
Sequence:CCGGATACGTTGAGAACGATTATACCTCGAGGTATAATCGTTCTCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017526
VALIDATED
ARHGAP8 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-664s21c1
Sequence:CCGGGAGCTCCACGAACACCTTAAACTCGAGTTTAAGGTGTTCGTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-611s21c1
Sequence:CCGGCCCTCATCAGTCACAAGTTTGCTCGAGCAAACTTGTGACTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-811s21c1
Sequence:CCGGTTTGGCGTCAGTCTGCAATACCTCGAGGTATTGCAGACTGACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-1538s21c1
Sequence:CCGGGTTGCGAACACTCTGTATATTCTCGAGAATATACAGAGTGTTCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-333s21c1
Sequence:CCGGATACGTTGAGAACGATTATACCTCGAGGTATAATCGTTCTCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017526
VALIDATED
ARHGAP8 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-664s21c1
Sequence:CCGGGAGCTCCACGAACACCTTAAACTCGAGTTTAAGGTGTTCGTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-611s21c1
Sequence:CCGGCCCTCATCAGTCACAAGTTTGCTCGAGCAAACTTGTGACTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-811s21c1
Sequence:CCGGTTTGGCGTCAGTCTGCAATACCTCGAGGTATTGCAGACTGACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-1538s21c1
Sequence:CCGGGTTGCGAACACTCTGTATATTCTCGAGAATATACAGAGTGTTCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001017526.1-333s21c1
Sequence:CCGGATACGTTGAGAACGATTATACCTCGAGGTATAATCGTTCTCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks