EMAIL THIS PAGE TO A FRIEND

ARHGAP9

Rho GTPase activating protein 9

252 Gene Product Result for
Synonyms: 10C RGL1
Gene ID:
Human(64333) Summary: This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(216445) Rho GTPase activating protein 9
Rat(362893) Rho GTPase activating protein 9
Zebrafish(100616531) Rho GTPase activating protein 9
domestic cat(101093282) Rho GTPase activating protein 9
Horse(100050388) Rho GTPase activating protein 9
cow(507960) Rho GTPase activating protein 9
dog(474413) Rho GTPase activating protein 9
domestic guinea pig(100722376) Rho GTPase activating protein 9
naked mole-rat(101717142) Rho GTPase activating protein 9
sheep(101119898) Rho GTPase activating protein 9
Domestic Rabbit(100344517) Rho GTPase activating protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080156 Rosetta Predictions human pricing
NM_001080157 Rosetta Predictions human pricing
NM_032496 Rosetta Predictions human pricing
NM_001012198 Rosetta Predictions rat pricing
NM_001080789 Rosetta Predictions rat pricing
NM_146011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314341 predicted 662
2 SASI_Hs02_00314342 predicted 1249
3 SASI_Hs02_00314343 predicted 443
4 SASI_Hs02_00314344 predicted 408
5 SASI_Hs02_00314345 predicted 683
6 SASI_Hs02_00314346 predicted 1248
7 SASI_Hs02_00314347 predicted 684
8 SASI_Hs02_00314348 predicted 1126
9 SASI_Hs02_00314349 predicted 1089
10 SASI_Hs02_00314350 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314351 predicted 1267
2 SASI_Hs02_00314352 predicted 1859
3 SASI_Hs02_00314353 predicted 1046
4 SASI_Hs02_00314354 predicted 1017
5 SASI_Hs02_00314355 predicted 1291
6 SASI_Hs02_00314356 predicted 1855
7 SASI_Hs02_00314357 predicted 1290
8 SASI_Hs02_00314358 predicted 1737
9 SASI_Hs02_00314359 predicted 1700
10 SASI_Hs02_00314360 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359966 predicted 1172
2 SASI_Hs02_00359967 predicted 1758
3 SASI_Hs02_00359968 predicted 949
4 SASI_Hs02_00359969 predicted 922
5 SASI_Hs02_00359970 predicted 1187
6 SASI_Hs02_00359971 predicted 1758
7 SASI_Hs01_00064435 predicted 1194
8 SASI_Hs02_00359972 predicted 1634
9 SASI_Hs02_00359973 predicted 1600
10 SASI_Hs02_00359974 predicted 917
11 SASI_Hs01_00064430 predicted 2529
12 SASI_Hs01_00064431 predicted 2238
13 SASI_Hs01_00064432 predicted 2493
14 SASI_Hs01_00064433 predicted 2470
15 SASI_Hs01_00064434 predicted 490
16 SASI_Hs01_00064436 predicted 970
17 SASI_Hs01_00064437 predicted 2255
18 SASI_Hs01_00064438 predicted 1100
19 SASI_Hs01_00064439 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200417 predicted 910
2 SASI_Rn02_00200418 predicted 1087
3 SASI_Rn02_00200419 predicted 1145
4 SASI_Rn02_00200420 predicted 1045
5 SASI_Rn02_00200421 predicted 1363
6 SASI_Rn02_00200422 predicted 875
7 SASI_Rn02_00200423 predicted 743
8 SASI_Rn02_00200424 predicted 1044
9 SASI_Rn02_00200425 predicted 1008
10 SASI_Rn02_00200426 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208519 predicted 1539
2 SASI_Rn02_00208520 predicted 1718
3 SASI_Rn02_00208521 predicted 1782
4 SASI_Rn02_00208522 predicted 1681
5 SASI_Rn02_00208523 predicted 1999
6 SASI_Rn02_00208524 predicted 1507
7 SASI_Rn02_00208525 predicted 1376
8 SASI_Rn02_00208526 predicted 1677
9 SASI_Rn02_00208527 predicted 1647
10 SASI_Rn02_00208528 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196479 predicted 1403
2 SASI_Mm01_00196480 predicted 963
3 SASI_Mm01_00196481 predicted 993
4 SASI_Mm01_00196482 predicted 950
5 SASI_Mm01_00196484 predicted 1126
6 SASI_Mm01_00196485 predicted 1242
7 SASI_Mm01_00196486 predicted 1086
8 SASI_Mm01_00196487 predicted 999
9 SASI_Mm01_00196488 predicted 818
10 SASI_Mm02_00341563 predicted 1455
11 SASI_Mm01_00196483 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146011
VALIDATED
ARHGAP9 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146011.2-1116s21c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1227s21c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-995s21c1
Sequence:CCGGTCTAGACGTGGATGGTATTTACTCGAGTAAATACCATCCACGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1555s21c1
Sequence:CCGGGAAGGCGCTTCCTGTGATTTGCTCGAGCAAATCACAGGAAGCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1375s21c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1611s1c1
Sequence:CCGGGAAGATACAATGTCCTCCCAACTCGAGTTGGGAGGACATTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1222s1c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1370s1c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-817s1c1
Sequence:CCGGCGGAACAAGTTAAAGCGGCTACTCGAGTAGCCGCTTTAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146011.1-1111s1c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146011
VALIDATED
ARHGAP9 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146011.2-1116s21c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1227s21c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-995s21c1
Sequence:CCGGTCTAGACGTGGATGGTATTTACTCGAGTAAATACCATCCACGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1555s21c1
Sequence:CCGGGAAGGCGCTTCCTGTGATTTGCTCGAGCAAATCACAGGAAGCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1375s21c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1611s1c1
Sequence:CCGGGAAGATACAATGTCCTCCCAACTCGAGTTGGGAGGACATTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1222s1c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1370s1c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-817s1c1
Sequence:CCGGCGGAACAAGTTAAAGCGGCTACTCGAGTAGCCGCTTTAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146011.1-1111s1c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146011
VALIDATED
ARHGAP9 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146011.2-1116s21c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1227s21c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-995s21c1
Sequence:CCGGTCTAGACGTGGATGGTATTTACTCGAGTAAATACCATCCACGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1555s21c1
Sequence:CCGGGAAGGCGCTTCCTGTGATTTGCTCGAGCAAATCACAGGAAGCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146011.2-1375s21c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1611s1c1
Sequence:CCGGGAAGATACAATGTCCTCCCAACTCGAGTTGGGAGGACATTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1222s1c1
Sequence:CCGGGCATTGTTGCTGCCTGACTTTCTCGAGAAAGTCAGGCAGCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-1370s1c1
Sequence:CCGGCACACTCGGATAAGAACCGAACTCGAGTTCGGTTCTTATCCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146011.1-817s1c1
Sequence:CCGGCGGAACAAGTTAAAGCGGCTACTCGAGTAGCCGCTTTAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146011.1-1111s1c1
Sequence:CCGGGCAGGACAAGAAGGCAAATTACTCGAGTAATTTGCCTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032496
VALIDATED
ARHGAP9 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1918s21c1
Sequence:GTACCGGACAAGAAGGTCGGTTAGATTTCTCGAGAAATCTAACCGACCTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032496.2-2402s21c1
Sequence:CCGGTTTGAGGATATCCCTTTAAATCTCGAGATTTAAAGGGATATCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-2093s21c1
Sequence:CCGGCAAGAATTAATAGGCTCAATGCTCGAGCATTGAGCCTATTAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1944s21c1
Sequence:CCGGGTACTGAGTGGGATGACATTCCTCGAGGAATGTCATCCCACTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-368s21c1
Sequence:CCGGTTCGTCCCAGCAGCCTATATGCTCGAGCATATAGGCTGCTGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-491s1c1
Sequence:CCGGGCCCTCTATGCCTTTACTTATCTCGAGATAAGTAAAGGCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-644s1c1
Sequence:CCGGGCAGCCTATATGATAGAGGAACTCGAGTTCCTCTATCATATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-1945s1c1
Sequence:CCGGCAACAAACTAAAGCGGCTCATCTCGAGATGAGCCGCTTTAGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2474s1c1
Sequence:CCGGGAGCATTTATGCAGGGTGATACTCGAGTATCACCCTGCATAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2250s1c1
Sequence:CCGGGTCGGTTAGATTTGGACAGTACTCGAGTACTGTCCAAATCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032496
VALIDATED
ARHGAP9 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1918s21c1
Sequence:GTACCGGACAAGAAGGTCGGTTAGATTTCTCGAGAAATCTAACCGACCTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032496.2-2402s21c1
Sequence:CCGGTTTGAGGATATCCCTTTAAATCTCGAGATTTAAAGGGATATCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-2093s21c1
Sequence:CCGGCAAGAATTAATAGGCTCAATGCTCGAGCATTGAGCCTATTAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1944s21c1
Sequence:CCGGGTACTGAGTGGGATGACATTCCTCGAGGAATGTCATCCCACTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-368s21c1
Sequence:CCGGTTCGTCCCAGCAGCCTATATGCTCGAGCATATAGGCTGCTGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-491s1c1
Sequence:CCGGGCCCTCTATGCCTTTACTTATCTCGAGATAAGTAAAGGCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-644s1c1
Sequence:CCGGGCAGCCTATATGATAGAGGAACTCGAGTTCCTCTATCATATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-1945s1c1
Sequence:CCGGCAACAAACTAAAGCGGCTCATCTCGAGATGAGCCGCTTTAGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2474s1c1
Sequence:CCGGGAGCATTTATGCAGGGTGATACTCGAGTATCACCCTGCATAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2250s1c1
Sequence:CCGGGTCGGTTAGATTTGGACAGTACTCGAGTACTGTCCAAATCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032496
VALIDATED
ARHGAP9 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1918s21c1
Sequence:GTACCGGACAAGAAGGTCGGTTAGATTTCTCGAGAAATCTAACCGACCTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032496.2-2402s21c1
Sequence:CCGGTTTGAGGATATCCCTTTAAATCTCGAGATTTAAAGGGATATCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-2093s21c1
Sequence:CCGGCAAGAATTAATAGGCTCAATGCTCGAGCATTGAGCCTATTAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-1944s21c1
Sequence:CCGGGTACTGAGTGGGATGACATTCCTCGAGGAATGTCATCCCACTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032496.2-368s21c1
Sequence:CCGGTTCGTCCCAGCAGCCTATATGCTCGAGCATATAGGCTGCTGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-491s1c1
Sequence:CCGGGCCCTCTATGCCTTTACTTATCTCGAGATAAGTAAAGGCATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032496.1-644s1c1
Sequence:CCGGGCAGCCTATATGATAGAGGAACTCGAGTTCCTCTATCATATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-1945s1c1
Sequence:CCGGCAACAAACTAAAGCGGCTCATCTCGAGATGAGCCGCTTTAGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2474s1c1
Sequence:CCGGGAGCATTTATGCAGGGTGATACTCGAGTATCACCCTGCATAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_032496.1-2250s1c1
Sequence:CCGGGTCGGTTAGATTTGGACAGTACTCGAGTACTGTCCAAATCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks