EMAIL THIS PAGE TO A FRIEND

ARHGDIA

Rho GDP dissociation inhibitor (GDI) alpha

112 Gene Product Result for
Synonyms: GDIA1 NPHS8 RHOGDI RHOGDI-1
UniProtKB ID: P52565, A8MXW0, B2R5X1, B4DDD3, B4DUV9, Q6IBM5
Gene ID:
Human(396) Summary: Aplysia Ras-related homologs (ARHs), also called Rho genes, belong to the RAS gene superfamily encoding small guanine nucleotide exchange (GTP/GDP) factors. The ARH proteins may be kept in the inactive, GDP-bound state by interaction with GDP dissociation inhibitors, such as ARHGDIA (Leffers et al., 1993 [PubMed 8262133]
Mouse(192662) Rho GDP dissociation inhibitor (GDI) alpha
Rat(360678) Rho GDP dissociation inhibitor (GDI) alpha
sheep(101114713) Rho GDP dissociation inhibitor (GDI) alpha
naked mole-rat(101713047) Rho GDP dissociation inhibitor (GDI) alpha
domestic guinea pig(100734224) Rho GDP dissociation inhibitor (GDI) alpha
Zebrafish(406770) Rho GDP dissociation inhibitor (GDI) alpha
chicken(769231) Rho GDP dissociation inhibitor (GDI) alpha
cow(338054) Rho GDP dissociation inhibitor (GDI) alpha
domestic cat(101089728) Rho GDP dissociation inhibitor (GDI) alpha
dog(475924) Rho GDP dissociation inhibitor (GDI) alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501458 Anti-ARHGDIA antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, pig, human, bovine, mouse
ELISA, western blot pricing
SAB1405483 Anti-ARHGDIA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA021407 Anti-ARHGDIA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4501747 Anti-ARHGDIA, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4504298 Anti-phospho-ARHGDIA (pSer174) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
R3025 Anti-Rho-GDI antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution, ~1 mg/mL bovine, human, mouse
immunoprecipitation, western blot pricing
WH0000396M2 Monoclonal Anti-ARHGDIA antibody produced in mouse clone 1G5-2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403570 Monoclonal Anti-ARHGDIA antibody produced in mouse clone 1E12-2G11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4100145 Monoclonal Anti-ARHGDIA antibody produced in mouse clone ARHGDIA-A109, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004309 siRNAs that have been validated in the lab human pricing
NM_001007005 Rosetta Predictions rat pricing
NM_133796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004309 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058983 validated 404
2 SASI_Hs02_00337330 predicted 490
3 SASI_Hs01_00058986 predicted 425
4 SASI_Hs01_00058981 predicted 1196
5 SASI_Hs02_00337331 predicted 429
6 SASI_Hs01_00058987 predicted 512
7 SASI_Hs01_00058988 predicted 432
8 SASI_Hs01_00058982 predicted 1190
9 SASI_Hs01_00058984 predicted 498
10 SASI_Hs01_00058985 predicted 443
11 SASI_Hs01_00058989 predicted 662
12 SASI_Hs01_00058990 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111579 predicted 1130
2 SASI_Rn01_00111580 predicted 205
3 SASI_Rn01_00111581 predicted 433
4 SASI_Rn01_00111582 predicted 430
5 SASI_Rn01_00111583 predicted 411
6 SASI_Rn01_00111584 predicted 780
7 SASI_Rn01_00111585 predicted 444
8 SASI_Rn01_00111586 predicted 289
9 SASI_Rn01_00111587 predicted 643
10 SASI_Rn01_00111588 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055343 predicted 818
2 SASI_Mm01_00055344 predicted 231
3 SASI_Mm01_00055345 predicted 396
4 SASI_Mm01_00055347 predicted 1146
5 SASI_Mm01_00055348 predicted 302
6 SASI_Mm01_00055349 predicted 1055
7 SASI_Mm01_00055350 predicted 458
8 SASI_Mm02_00338822 predicted 318
9 SASI_Mm01_00055351 predicted 453
10 SASI_Mm02_00338823 predicted 712
11 SASI_Mm01_00055346 predicted 445
12 SASI_Mm01_00055352 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133796
ARHGDIA MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) alpha
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-858s1c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-567s1c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-579s1c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-651s1c1
Sequence:CCGGTCCGGCATGAAGTACATCCAACTCGAGTTGGATGTACTTCATGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-389s21c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-680s21c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133796.6-1571s21c1
Sequence:CCGGGCCTGGCCTGTCAGTATTTATCTCGAGATAAATACTGACAGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-401s21c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133796
ARHGDIA MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) alpha
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-858s1c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-567s1c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-579s1c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-651s1c1
Sequence:CCGGTCCGGCATGAAGTACATCCAACTCGAGTTGGATGTACTTCATGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-389s21c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-680s21c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133796.6-1571s21c1
Sequence:CCGGGCCTGGCCTGTCAGTATTTATCTCGAGATAAATACTGACAGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-401s21c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133796
ARHGDIA MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) alpha
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-858s1c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-567s1c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-579s1c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133796.3-651s1c1
Sequence:CCGGTCCGGCATGAAGTACATCCAACTCGAGTTGGATGTACTTCATGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-389s21c1
Sequence:CCGGAGCTTCAAGAAACAGTCGTTTCTCGAGAAACGACTGTTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-680s21c1
Sequence:CCGGGAGTGGAATCTCACCATCAAACTCGAGTTTGATGGTGAGATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133796.6-1571s21c1
Sequence:CCGGGCCTGGCCTGTCAGTATTTATCTCGAGATAAATACTGACAGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133796.6-401s21c1
Sequence:CCGGCAGTCGTTTGTCTTGAAGGAACTCGAGTTCCTTCAAGACAAACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004309
VALIDATED
ARHGDIA MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-1198s1c1
Sequence:CCGGCGTCTAACCATGATGCCTTAACTCGAGTTAAGGCATCATGGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-503s1c1
Sequence:CCGGCAAGATTGACAAGACTGACTACTCGAGTAGTCAGTCTTGTCAATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-519s1c1
Sequence:CCGGGACTACATGGTAGGCAGCTATCTCGAGATAGCTGCCTACCATGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-629s1c1
Sequence:CCGGCCGCTTCACAGACGACGACAACTCGAGTTGTCGTCGTCTGTGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004309.3-378s1c1
Sequence:CCGGAGCTTCAAGAAGCAGTCGTTTCTCGAGAAACGACTGCTTCTTGAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-228s21c1
Sequence:CCGGGAGAGCCTGCGAAAGTACAAGCTCGAGCTTGTACTTTCGCAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-154s21c1
Sequence:CCGGATGAGCACTCGGTCAACTACACTCGAGTGTAGTTGACCGAGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004309.3-786s21c1
Sequence:CCGGCCCATACCAAAGTGCTGACAGCTCGAGCTGTCAGCACTTTGGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-439s21c1
Sequence:CCGGTCCGGGTTAACCGAGAGATAGCTCGAGCTATCTCTCGGTTAACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004309
VALIDATED
ARHGDIA MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-1198s1c1
Sequence:CCGGCGTCTAACCATGATGCCTTAACTCGAGTTAAGGCATCATGGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-503s1c1
Sequence:CCGGCAAGATTGACAAGACTGACTACTCGAGTAGTCAGTCTTGTCAATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-519s1c1
Sequence:CCGGGACTACATGGTAGGCAGCTATCTCGAGATAGCTGCCTACCATGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-629s1c1
Sequence:CCGGCCGCTTCACAGACGACGACAACTCGAGTTGTCGTCGTCTGTGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004309.3-378s1c1
Sequence:CCGGAGCTTCAAGAAGCAGTCGTTTCTCGAGAAACGACTGCTTCTTGAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-228s21c1
Sequence:CCGGGAGAGCCTGCGAAAGTACAAGCTCGAGCTTGTACTTTCGCAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-154s21c1
Sequence:CCGGATGAGCACTCGGTCAACTACACTCGAGTGTAGTTGACCGAGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004309.3-786s21c1
Sequence:CCGGCCCATACCAAAGTGCTGACAGCTCGAGCTGTCAGCACTTTGGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-439s21c1
Sequence:CCGGTCCGGGTTAACCGAGAGATAGCTCGAGCTATCTCTCGGTTAACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004309
VALIDATED
ARHGDIA MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-1198s1c1
Sequence:CCGGCGTCTAACCATGATGCCTTAACTCGAGTTAAGGCATCATGGTTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-503s1c1
Sequence:CCGGCAAGATTGACAAGACTGACTACTCGAGTAGTCAGTCTTGTCAATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-519s1c1
Sequence:CCGGGACTACATGGTAGGCAGCTATCTCGAGATAGCTGCCTACCATGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004309.3-629s1c1
Sequence:CCGGCCGCTTCACAGACGACGACAACTCGAGTTGTCGTCGTCTGTGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004309.3-378s1c1
Sequence:CCGGAGCTTCAAGAAGCAGTCGTTTCTCGAGAAACGACTGCTTCTTGAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-228s21c1
Sequence:CCGGGAGAGCCTGCGAAAGTACAAGCTCGAGCTTGTACTTTCGCAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-154s21c1
Sequence:CCGGATGAGCACTCGGTCAACTACACTCGAGTGTAGTTGACCGAGTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004309.3-786s21c1
Sequence:CCGGCCCATACCAAAGTGCTGACAGCTCGAGCTGTCAGCACTTTGGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004309.3-439s21c1
Sequence:CCGGTCCGGGTTAACCGAGAGATAGCTCGAGCTATCTCTCGGTTAACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks