EMAIL THIS PAGE TO A FRIEND

ARHGDIB

Rho GDP dissociation inhibitor (GDI) beta

63 Gene Product Result for
Synonyms: D4 GDIA2 GDID4 LYGDI Ly-GDI RAP1GN1 RhoGDI2
UniProtKB ID: P52566, B5BU79
Gene ID:
Human(397) Summary: Members of the Rho (or ARH) protein family (see MIM 165390) and other Ras-related small GTP-binding proteins (see MIM 179520) are involved in diverse cellular events, including cell signaling, proliferation, cytoskeletal organization, and secretion. The GTP-binding proteins are active only in the GTP-bound state. At least 3 classes of proteins tightly regulate cycling between the GTP-bound and GDP-bound states: GTPase-activating proteins (GAPs), guanine nucleotide-releasing factors (GRFs), and GDP-dissociation inhibitors (GDIs). The GDIs, including ARHGDIB, decrease the rate of GDP dissociation from Ras-like GTPases (summary by Scherle et al., 1993 [PubMed 8356058]
Mouse(11857) Rho, GDP dissociation inhibitor (GDI) beta
Rat(362456) Rho, GDP dissociation inhibitor (GDI) beta
chicken(417941) Rho GDP dissociation inhibitor (GDI) beta
dog(486666) Rho GDP dissociation inhibitor (GDI) beta
cow(327676) Rho GDP dissociation inhibitor (GDI) beta
domestic cat(101097252) Rho GDP dissociation inhibitor (GDI) beta
domestic guinea pig(100735099) Rho GDP dissociation inhibitor (GDI) beta
naked mole-rat(101717849) Rho GDP dissociation inhibitor (GDI) beta
sheep(101106069) Rho GDP dissociation inhibitor (GDI) beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001175 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031071 MISSION® esiRNA esiRNA targeting mouse Arhgdib (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001175 Rosetta Predictions human pricing
NM_001009600 Rosetta Predictions rat pricing
NM_007486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125904 predicted 342
2 SASI_Hs01_00125905 predicted 671
3 SASI_Hs01_00125906 predicted 651
4 SASI_Hs01_00125907 predicted 866
5 SASI_Hs01_00125908 predicted 447
6 SASI_Hs01_00125909 predicted 229
7 SASI_Hs02_00331300 predicted 514
8 SASI_Hs01_00125911 predicted 683
9 SASI_Hs01_00125912 predicted 606
10 SASI_Hs02_00331301 predicted 395
11 SASI_Hs01_00125910 predicted 953
12 SASI_Hs01_00125913 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199609 predicted 405
2 SASI_Rn01_00072107 predicted 304
3 SASI_Rn01_00072108 predicted 311
4 SASI_Rn01_00072109 predicted 421
5 SASI_Rn02_00199610 predicted 388
6 SASI_Rn01_00072110 predicted 460
7 SASI_Rn01_00072111 predicted 331
8 SASI_Rn01_00072112 predicted 391
9 SASI_Rn01_00072113 predicted 370
10 SASI_Rn01_00072114 predicted 379
11 SASI_Rn01_00072115 predicted 320
12 SASI_Rn01_00072116 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131461 predicted 339
2 SASI_Mm01_00131463 predicted 257
3 SASI_Mm01_00131464 predicted 285
4 SASI_Mm01_00131465 predicted 439
5 SASI_Mm01_00131466 predicted 322
6 SASI_Mm02_00311753 predicted 463
7 SASI_Mm01_00131467 predicted 274
8 SASI_Mm01_00131468 predicted 529
9 SASI_Mm02_00311754 predicted 199
10 SASI_Mm01_00131470 predicted 273
11 SASI_Mm01_00131462 predicted 324
12 SASI_Mm01_00131469 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001175
VALIDATED
ARHGDIB MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1053s21c1
Sequence:CCGGGTTCCAGTAGTTCATTCTAATCTCGAGATTAGAATGAACTACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-951s21c1
Sequence:CCGGCATCTCAGTACACAATCATTTCTCGAGAAATGATTGTGTACTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1026s21c1
Sequence:CCGGATTATCACTAACAGGTCTTTGCTCGAGCAAAGACCTGTTAGTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-517s1c1
Sequence:CCGGGCCTGAAATACGTTCAGCACACTCGAGTGTGCTGAACGTATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-268s1c1
Sequence:CCGGACAAAGATGATGAGAGTCTAACTCGAGTTAGACTCTCATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-321s1c1
Sequence:CCGGCCTGTGGTGACAGATCCGAAACTCGAGTTTCGGATCTGTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-722s1c1
Sequence:CCGGGTGGAACCTGTCGATTAAGAACTCGAGTTCTTAATCGACAGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001175.1-441s1c1
Sequence:CCGGGAAACCATTGTGTTAAAGGAACTCGAGTTCCTTTAACACAATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001175
VALIDATED
ARHGDIB MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1053s21c1
Sequence:CCGGGTTCCAGTAGTTCATTCTAATCTCGAGATTAGAATGAACTACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-951s21c1
Sequence:CCGGCATCTCAGTACACAATCATTTCTCGAGAAATGATTGTGTACTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1026s21c1
Sequence:CCGGATTATCACTAACAGGTCTTTGCTCGAGCAAAGACCTGTTAGTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-517s1c1
Sequence:CCGGGCCTGAAATACGTTCAGCACACTCGAGTGTGCTGAACGTATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-268s1c1
Sequence:CCGGACAAAGATGATGAGAGTCTAACTCGAGTTAGACTCTCATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-321s1c1
Sequence:CCGGCCTGTGGTGACAGATCCGAAACTCGAGTTTCGGATCTGTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-722s1c1
Sequence:CCGGGTGGAACCTGTCGATTAAGAACTCGAGTTCTTAATCGACAGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001175.1-441s1c1
Sequence:CCGGGAAACCATTGTGTTAAAGGAACTCGAGTTCCTTTAACACAATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001175
VALIDATED
ARHGDIB MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1053s21c1
Sequence:CCGGGTTCCAGTAGTTCATTCTAATCTCGAGATTAGAATGAACTACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-951s21c1
Sequence:CCGGCATCTCAGTACACAATCATTTCTCGAGAAATGATTGTGTACTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001175.4-1026s21c1
Sequence:CCGGATTATCACTAACAGGTCTTTGCTCGAGCAAAGACCTGTTAGTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-517s1c1
Sequence:CCGGGCCTGAAATACGTTCAGCACACTCGAGTGTGCTGAACGTATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-268s1c1
Sequence:CCGGACAAAGATGATGAGAGTCTAACTCGAGTTAGACTCTCATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-321s1c1
Sequence:CCGGCCTGTGGTGACAGATCCGAAACTCGAGTTTCGGATCTGTCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001175.1-722s1c1
Sequence:CCGGGTGGAACCTGTCGATTAAGAACTCGAGTTCTTAATCGACAGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001175.1-441s1c1
Sequence:CCGGGAAACCATTGTGTTAAAGGAACTCGAGTTCCTTTAACACAATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007486
VALIDATED
ARHGDIB MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-202s21c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007486.4-814s21c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-469s21c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-481s21c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007486.1-815s1c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-482s1c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-657s1c1
Sequence:CCGGGCCATTAAGAAGGATTGGACACTCGAGTGTCCAATCCTTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007486.1-470s1c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-203s1c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007486
VALIDATED
ARHGDIB MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-202s21c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007486.4-814s21c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-469s21c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-481s21c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007486.1-815s1c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-482s1c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-657s1c1
Sequence:CCGGGCCATTAAGAAGGATTGGACACTCGAGTGTCCAATCCTTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007486.1-470s1c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-203s1c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007486
VALIDATED
ARHGDIB MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-202s21c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007486.4-814s21c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-469s21c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007486.4-481s21c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007486.1-815s1c1
Sequence:CCGGCACACATTTCATCACCAATATCTCGAGATATTGGTGATGAAATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-482s1c1
Sequence:CCGGAGTGGATAAAGCCACATTCATCTCGAGATGAATGTGGCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-657s1c1
Sequence:CCGGGCCATTAAGAAGGATTGGACACTCGAGTGTCCAATCCTTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007486.1-470s1c1
Sequence:CCGGGACTGGCATGAGAGTGGATAACTCGAGTTATCCACTCTCATGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007486.1-203s1c1
Sequence:CCGGCGAGAGTCTAACCAAGTACAACTCGAGTTGTACTTGGTTAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks