EMAIL THIS PAGE TO A FRIEND

ARHGDIG

Rho GDP dissociation inhibitor (GDI) gamma

58 Gene Product Result for
Synonyms: RHOGDI-3
UniProtKB ID: Q99819, Q4TT69, Q96S29
Gene ID:
Human(398) Summary: The GDP-dissociation inhibitors (GDIs) play a primary role in modulating the activation of GTPases by inhibiting the exchange of GDP for GTP. See ARHGDIB (MIM 602843).[supplied by OMIM, Nov 2010]
Mouse(14570) Rho GDP dissociation inhibitor (GDI) gamma
Rat(360500) Rho GDP dissociation inhibitor (GDI) gamma
sheep(101122156) Rho GDP dissociation inhibitor (GDI) gamma
naked mole-rat(101702221) Rho GDP dissociation inhibitor (GDI) gamma
domestic guinea pig(100718258) Rho GDP dissociation inhibitor (GDI) gamma
Zebrafish(394132) Rho GDP dissociation inhibitor (GDI) gamma
cow(613745) Rho GDP dissociation inhibitor (GDI) gamma
chicken(100858938) Rho GDP dissociation inhibitor (GDI) gamma
dog(611541) Rho GDP dissociation inhibitor (GDI) gamma
domestic cat(101096279) Rho GDP dissociation inhibitor (GDI) gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219931 MISSION® esiRNA esiRNA targeting human ARHGDIG human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001176 Rosetta Predictions human pricing
NM_001108269 Rosetta Predictions rat pricing
NM_008113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097419 predicted 559
2 SASI_Hs01_00097420 predicted 433
3 SASI_Hs01_00097421 predicted 492
4 SASI_Hs01_00097422 predicted 437
5 SASI_Hs01_00097423 predicted 446
6 SASI_Hs01_00097424 predicted 506
7 SASI_Hs01_00097426 predicted 495
8 SASI_Hs02_00331302 predicted 564
9 SASI_Hs02_00331303 predicted 442
10 SASI_Hs02_00331304 predicted 359
11 SASI_Hs01_00097418 predicted 459
12 SASI_Hs01_00097425 predicted 456
13 SASI_Hs01_00097427 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236994 predicted 623
2 SASI_Rn02_00236995 predicted 585
3 SASI_Rn02_00236996 predicted 514
4 SASI_Rn02_00236997 predicted 632
5 SASI_Rn02_00236998 predicted 396
6 SASI_Rn02_00236999 predicted 630
7 SASI_Rn02_00237000 predicted 544
8 SASI_Rn02_00237001 predicted 528
9 SASI_Rn02_00237002 predicted 476
10 SASI_Rn02_00237003 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313175 predicted 627
2 SASI_Mm01_00129836 predicted 785
3 SASI_Mm01_00129838 predicted 397
4 SASI_Mm01_00129839 predicted 624
5 SASI_Mm01_00129840 predicted 514
6 SASI_Mm01_00129841 predicted 638
7 SASI_Mm01_00129842 predicted 723
8 SASI_Mm01_00129843 predicted 537
9 SASI_Mm01_00129844 predicted 725
10 SASI_Mm01_00129845 predicted 326
11 SASI_Mm01_00129837 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001176
VALIDATED
ARHGDIG MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) gamma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-426s1c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-438s1c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-415s1c1
Sequence:CCGGCAGGTGTTTGTCCTGAAGGAACTCGAGTTCCTTCAGGACAAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-575s1c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001176.1-531s1c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-552s21c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-596s21c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-459s21c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-447s21c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001176
VALIDATED
ARHGDIG MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) gamma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-426s1c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-438s1c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-415s1c1
Sequence:CCGGCAGGTGTTTGTCCTGAAGGAACTCGAGTTCCTTCAGGACAAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-575s1c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001176.1-531s1c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-552s21c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-596s21c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-459s21c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-447s21c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001176
VALIDATED
ARHGDIG MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) gamma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-426s1c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-438s1c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-415s1c1
Sequence:CCGGCAGGTGTTTGTCCTGAAGGAACTCGAGTTCCTTCAGGACAAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001176.1-575s1c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001176.1-531s1c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-552s21c1
Sequence:CCGGCGTGGACAAGACCGTCTACATCTCGAGATGTAGACGGTCTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-596s21c1
Sequence:CCGGCCCAGGAGTATGAGTTTGTGACTCGAGTCACAAACTCATACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-459s21c1
Sequence:CCGGTGTTGATTACAGAGTGAAGATCTCGAGATCTTCACTCTGTAATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001176.3-447s21c1
Sequence:CCGGCCTGAAGGAAGGTGTTGATTACTCGAGTAATCAACACCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008113
ARHGDIG MISSION shRNA Bacterial Glycerol Stock
Rho GDP dissociation inhibitor (GDI) gamma
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-728s1c1
Sequence:CCGGAGGAGTATGAATTTGTGACTTCTCGAGAAGTCACAAATTCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-520s1c1
Sequence:CCGGCCTATCATCATGGACCTTACACTCGAGTGTAAGGTCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-273s1c1
Sequence:CCGGCCGAGTCCTCTTGGCTGACAACTCGAGTTGTCAGCCAAGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008113
ARHGDIG MISSION shRNA shRNA Plasmid DNA
Rho GDP dissociation inhibitor (GDI) gamma
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-728s1c1
Sequence:CCGGAGGAGTATGAATTTGTGACTTCTCGAGAAGTCACAAATTCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-520s1c1
Sequence:CCGGCCTATCATCATGGACCTTACACTCGAGTGTAAGGTCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-273s1c1
Sequence:CCGGCCGAGTCCTCTTGGCTGACAACTCGAGTTGTCAGCCAAGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008113
ARHGDIG MISSION shRNA Lentiviral Transduction Particles
Rho GDP dissociation inhibitor (GDI) gamma
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-728s1c1
Sequence:CCGGAGGAGTATGAATTTGTGACTTCTCGAGAAGTCACAAATTCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-520s1c1
Sequence:CCGGCCTATCATCATGGACCTTACACTCGAGTGTAAGGTCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008113.2-273s1c1
Sequence:CCGGCCGAGTCCTCTTGGCTGACAACTCGAGTTGTCAGCCAAGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks