EMAIL THIS PAGE TO A FRIEND

ARHGEF10

Rho guanine nucleotide exchange factor (GEF) 10

70 Gene Product Result for
Synonyms: GEF10
UniProtKB ID: O15013, O14665, Q2KHR8, Q68D55, Q8IWD9, Q8IY77
Gene ID:
Human(9639) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. [provided by RefSeq, Jul 2008]
Mouse(234094) Rho guanine nucleotide exchange factor (GEF) 10
sheep(101104295) Rho guanine nucleotide exchange factor (GEF) 10
naked mole-rat(101704100) Rho guanine nucleotide exchange factor (GEF) 10
domestic guinea pig(100722316) Rho guanine nucleotide exchange factor (GEF) 10
Zebrafish(334278) Rho guanine nucleotide exchange factor (GEF) 10
cow(100138303) Rho guanine nucleotide exchange factor (GEF) 10
domestic cat(101081797) Rho guanine nucleotide exchange factor (GEF) 10
dog(609511) Rho guanine nucleotide exchange factor (GEF) 10
chicken(421900) Rho guanine nucleotide exchange factor (GEF) 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014629 Rosetta Predictions human pricing
NM_001037736 Rosetta Predictions mouse pricing
NM_172751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025154 predicted 3307
2 SASI_Hs01_00025155 predicted 1397
3 SASI_Hs02_00345925 predicted 2047
4 SASI_Hs01_00025156 predicted 3719
5 SASI_Hs01_00025158 predicted 3902
6 SASI_Hs01_00025160 predicted 412
7 SASI_Hs01_00025161 predicted 1022
8 SASI_Hs01_00025162 predicted 682
9 SASI_Hs02_00345926 predicted 3306
10 SASI_Hs02_00345927 predicted 2147
11 SASI_Hs01_00025157 predicted 2438
12 SASI_Hs01_00025159 predicted 4295
13 SASI_Hs01_00025163 predicted 2430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289376 predicted 2383
2 SASI_Mm02_00289377 predicted 3967
3 SASI_Mm02_00289378 predicted 445
4 SASI_Mm02_00289379 predicted 3093
5 SASI_Mm02_00289380 predicted 254
6 SASI_Mm02_00289381 predicted 2029
7 SASI_Mm02_00289382 predicted 3036
8 SASI_Mm02_00289383 predicted 2317
9 SASI_Mm02_00289384 predicted 1840
10 SASI_Mm02_00289385 predicted 3058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186185 predicted 2498
2 SASI_Mm02_00344590 predicted 4086
3 SASI_Mm02_00344591 predicted 451
4 SASI_Mm01_00186187 predicted 3205
5 SASI_Mm02_00344592 predicted 255
6 SASI_Mm01_00186190 predicted 3150
7 SASI_Mm01_00186192 predicted 2434
8 SASI_Mm01_00186193 predicted 1956
9 SASI_Mm02_00344593 predicted 3183
10 SASI_Mm02_00344594 predicted 2806
11 SASI_Mm01_00186186 predicted 908
12 SASI_Mm01_00186188 predicted 608
13 SASI_Mm01_00186189 predicted 1805
14 SASI_Mm01_00186191 predicted 1440
15 SASI_Mm01_00186194 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172751
VALIDATED
ARHGEF10 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-4129s1c1
Sequence:CCGGCCCATCATTCACCTGATACATCTCGAGATGTATCAGGTGAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-2083s1c1
Sequence:CCGGCGAGGGAGCTATCAGAACTTACTCGAGTAAGTTCTGATAGCTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-1610s1c1
Sequence:CCGGGCGAAATCAAACAAATAGCAACTCGAGTTGCTATTTGTTTGATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-2470s1c1
Sequence:CCGGCCTGAACCTTACCTGAGCAATCTCGAGATTGCTCAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-3572s1c1
Sequence:CCGGCCCTAGGATTGCCAACTCAAACTCGAGTTTGAGTTGGCAATCCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-1419s21c1
Sequence:CCGGTAGATGCTCTCCGGAGGATTTCTCGAGAAATCCTCCGGAGAGCATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-498s21c1
Sequence:CCGGCGTCATCTCCAGACGCGAATACTCGAGTATTCGCGTCTGGAGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172751
VALIDATED
ARHGEF10 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-4129s1c1
Sequence:CCGGCCCATCATTCACCTGATACATCTCGAGATGTATCAGGTGAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-2083s1c1
Sequence:CCGGCGAGGGAGCTATCAGAACTTACTCGAGTAAGTTCTGATAGCTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-1610s1c1
Sequence:CCGGGCGAAATCAAACAAATAGCAACTCGAGTTGCTATTTGTTTGATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-2470s1c1
Sequence:CCGGCCTGAACCTTACCTGAGCAATCTCGAGATTGCTCAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-3572s1c1
Sequence:CCGGCCCTAGGATTGCCAACTCAAACTCGAGTTTGAGTTGGCAATCCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-1419s21c1
Sequence:CCGGTAGATGCTCTCCGGAGGATTTCTCGAGAAATCCTCCGGAGAGCATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-498s21c1
Sequence:CCGGCGTCATCTCCAGACGCGAATACTCGAGTATTCGCGTCTGGAGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172751
VALIDATED
ARHGEF10 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-4129s1c1
Sequence:CCGGCCCATCATTCACCTGATACATCTCGAGATGTATCAGGTGAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172751.1-2083s1c1
Sequence:CCGGCGAGGGAGCTATCAGAACTTACTCGAGTAAGTTCTGATAGCTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-1610s1c1
Sequence:CCGGGCGAAATCAAACAAATAGCAACTCGAGTTGCTATTTGTTTGATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-2470s1c1
Sequence:CCGGCCTGAACCTTACCTGAGCAATCTCGAGATTGCTCAGGTAAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172751.1-3572s1c1
Sequence:CCGGCCCTAGGATTGCCAACTCAAACTCGAGTTTGAGTTGGCAATCCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-1419s21c1
Sequence:CCGGTAGATGCTCTCCGGAGGATTTCTCGAGAAATCCTCCGGAGAGCATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172751.2-498s21c1
Sequence:CCGGCGTCATCTCCAGACGCGAATACTCGAGTATTCGCGTCTGGAGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014629
VALIDATED
ARHGEF10 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-4977s1c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-3803s1c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5195s1c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-6650s1c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5694s1c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-3766s21c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2311s21c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2810s21c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2093s21c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-919s21c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014629
VALIDATED
ARHGEF10 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-4977s1c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-3803s1c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5195s1c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-6650s1c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5694s1c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-3766s21c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2311s21c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2810s21c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2093s21c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-919s21c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014629
VALIDATED
ARHGEF10 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-4977s1c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-3803s1c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5195s1c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-6650s1c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014629.1-5694s1c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-3766s21c1
Sequence:CCGGGCACGAGAAAGACAAGGACAACTCGAGTTGTCCTTGTCTTTCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2311s21c1
Sequence:CCGGCGCGAAACCAAACAAAGTTTACTCGAGTAAACTTTGTTTGGTTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2810s21c1
Sequence:CCGGCCTGAACCTTACCTAAATAATCTCGAGATTATTTAGGTAAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-2093s21c1
Sequence:CCGGCGCCGAGTCTTCATGTTAAATCTCGAGATTTAACATGAAGACTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014629.2-919s21c1
Sequence:CCGGCGGATGGAGTTCGAGTGAATTCTCGAGAATTCACTCGAACTCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)