EMAIL THIS PAGE TO A FRIEND

ARHGEF10L

Rho guanine nucleotide exchange factor (GEF) 10-like

90 Gene Product Result for
Synonyms: GrinchGEF
Gene ID:
Human(55160) Summary: ARHGEF10L is a member of the RhoGEF family of guanine nucleotide exchange factors (GEFs) that activate Rho GTPases (Winkler et al., 2005 [PubMed 16112081]
Mouse(72754) Rho guanine nucleotide exchange factor (GEF) 10-like
Rat(684811) Rho guanine nucleotide exchange factor (GEF) 10-like
chicken(419360) Rho guanine nucleotide exchange factor (GEF) 10-like
dog(487411) Rho guanine nucleotide exchange factor (GEF) 10-like
domestic cat(101086991) Rho guanine nucleotide exchange factor (GEF) 10-like
cow(529043) Rho guanine nucleotide exchange factor (GEF) 10-like
Horse(100052916) Rho guanine nucleotide exchange factor (GEF) 10-like
domestic guinea pig(100727225) Rho guanine nucleotide exchange factor (GEF) 10-like
naked mole-rat(101724075) Rho guanine nucleotide exchange factor (GEF) 10-like
Domestic Rabbit(100351713) Rho guanine nucleotide exchange factor (GEF) 10-like
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011722 Rosetta Predictions human pricing
NM_018125 Rosetta Predictions human pricing
NM_001112722 Rosetta Predictions mouse pricing
NM_001112723 Rosetta Predictions mouse pricing
NM_172415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077598 predicted 998
2 SASI_Hs01_00077599 predicted 384
3 SASI_Hs01_00077600 predicted 1270
4 SASI_Hs02_00306037 predicted 1266
5 SASI_Hs01_00077601 predicted 3372
6 SASI_Hs01_00077603 predicted 3823
7 SASI_Hs02_00306038 predicted 3423
8 SASI_Hs02_00306039 predicted 1123
9 SASI_Hs01_00077606 predicted 3302
10 SASI_Hs01_00077607 predicted 2049
11 SASI_Hs01_00077602 predicted 1001
12 SASI_Hs01_00077604 predicted 3116
13 SASI_Hs01_00077605 predicted 2483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056060 predicted 1239
2 SASI_Hs01_00056061 predicted 498
3 SASI_Hs01_00056062 predicted 1503
4 SASI_Hs02_00351334 predicted 1500
5 SASI_Hs01_00056063 predicted 3604
6 SASI_Hs01_00056065 predicted 4049
7 SASI_Hs02_00351335 predicted 3657
8 SASI_Hs02_00351336 predicted 1355
9 SASI_Hs01_00056068 predicted 3540
10 SASI_Hs01_00056069 predicted 2283
11 SASI_Hs01_00056064 predicted 1227
12 SASI_Hs01_00056066 predicted 3340
13 SASI_Hs01_00056067 predicted 2706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307013 predicted 1066
2 SASI_Mm02_00307014 predicted 2293
3 SASI_Mm02_00307015 predicted 1237
4 SASI_Mm02_00307016 predicted 1440
5 SASI_Mm02_00307017 predicted 1412
6 SASI_Mm02_00307018 predicted 530
7 SASI_Mm02_00307019 predicted 2319
8 SASI_Mm02_00307020 predicted 2653
9 SASI_Mm02_00307021 predicted 3063
10 SASI_Mm02_00307022 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307023 predicted 1038
2 SASI_Mm02_00307024 predicted 2248
3 SASI_Mm02_00307025 predicted 1203
4 SASI_Mm02_00307026 predicted 1416
5 SASI_Mm02_00307027 predicted 1389
6 SASI_Mm02_00307028 predicted 507
7 SASI_Mm02_00307029 predicted 2282
8 SASI_Mm02_00307030 predicted 2607
9 SASI_Mm02_00307031 predicted 3018
10 SASI_Mm02_00307032 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116820 predicted 1155
2 SASI_Mm01_00116821 predicted 2373
3 SASI_Mm02_00343884 predicted 1321
4 SASI_Mm01_00116824 predicted 1537
5 SASI_Mm01_00116825 predicted 1504
6 SASI_Mm01_00116828 predicted 504
7 SASI_Mm02_00343885 predicted 2401
8 SASI_Mm02_00343886 predicted 2721
9 SASI_Mm02_00343887 predicted 3129
10 SASI_Mm02_00343888 predicted 1327
11 SASI_Mm01_00116822 predicted 978
12 SASI_Mm01_00116823 predicted 822
13 SASI_Mm01_00116826 predicted 1338
14 SASI_Mm01_00116827 predicted 2167
15 SASI_Mm01_00116829 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018125
ARHGEF10L MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 10-like
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1769s21c1
Sequence:CCGGTGCTCCTGTGTGAGACGTTGACTCGAGTCAACGTCTCACACAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-505s21c1
Sequence:CCGGCGCATTGACCGGTTCACTTTCCTCGAGGAAAGTGAACCGGTCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-2740s21c1
Sequence:CCGGGTGCTCTGCATGGAGTATATCCTCGAGGATATACTCCATGCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1155s21c1
Sequence:CCGGGGAGTCTCTGAAGCGGATACTCTCGAGAGTATCCGCTTCAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3778s21c1
Sequence:CCGGGACGGCTCCATTTACGAGATGCTCGAGCATCTCGTAAATGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-798s21c1
Sequence:CCGGGAGATACGCCAGGACTAAGAGCTCGAGCTCTTAGTCCTGGCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018125.3-4098s21c1
Sequence:CCGGTGGACTCTCCAGAAACTACTTCTCGAGAAGTAGTTTCTGGAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3202s21c1
Sequence:CCGGAGCGTGACACACATGGTGAAGCTCGAGCTTCACCATGTGTGTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1028s21c1
Sequence:CCGGAGGTCAGCGTTTCGGACATCACTCGAGTGATGTCCGAAACGCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3980s21c1
Sequence:CCGGAGGTGCCCTTGATGCTATAGCCTCGAGGCTATAGCATCAAGGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-258s21c1
Sequence:CCGGGGCGTTTGAGTTTGATGACAGCTCGAGCTGTCATCAAACTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2076s1c1
Sequence:CCGGGCAGGCTCAGAATAAGGTGTACTCGAGTACACCTTATTCTGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-2464s1c1
Sequence:CCGGGATGAGGACAAGAAGAGCAAACTCGAGTTTGCTCTTCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2342s1c1
Sequence:CCGGCCATTAGCTTCATGGTGGTTTCTCGAGAAACCACCATGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-867s1c1
Sequence:CCGGGCACAAGTACGATTGTAAGATCTCGAGATCTTACAATCGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2394s1c1
Sequence:CCGGCTGGGTCAACAGGTTACATTTCTCGAGAAATGTAACCTGTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-3294s1c1
Sequence:CCGGGCATCTGCAAGAGATCAACATCTCGAGATGTTGATCTCTTGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-1546s1c1
Sequence:CCGGCCACAGTTCATACTCCTGCTTCTCGAGAAGCAGGAGTATGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018125
ARHGEF10L MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 10-like
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1769s21c1
Sequence:CCGGTGCTCCTGTGTGAGACGTTGACTCGAGTCAACGTCTCACACAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-505s21c1
Sequence:CCGGCGCATTGACCGGTTCACTTTCCTCGAGGAAAGTGAACCGGTCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-2740s21c1
Sequence:CCGGGTGCTCTGCATGGAGTATATCCTCGAGGATATACTCCATGCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1155s21c1
Sequence:CCGGGGAGTCTCTGAAGCGGATACTCTCGAGAGTATCCGCTTCAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3778s21c1
Sequence:CCGGGACGGCTCCATTTACGAGATGCTCGAGCATCTCGTAAATGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-798s21c1
Sequence:CCGGGAGATACGCCAGGACTAAGAGCTCGAGCTCTTAGTCCTGGCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018125.3-4098s21c1
Sequence:CCGGTGGACTCTCCAGAAACTACTTCTCGAGAAGTAGTTTCTGGAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3202s21c1
Sequence:CCGGAGCGTGACACACATGGTGAAGCTCGAGCTTCACCATGTGTGTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1028s21c1
Sequence:CCGGAGGTCAGCGTTTCGGACATCACTCGAGTGATGTCCGAAACGCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3980s21c1
Sequence:CCGGAGGTGCCCTTGATGCTATAGCCTCGAGGCTATAGCATCAAGGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-258s21c1
Sequence:CCGGGGCGTTTGAGTTTGATGACAGCTCGAGCTGTCATCAAACTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2076s1c1
Sequence:CCGGGCAGGCTCAGAATAAGGTGTACTCGAGTACACCTTATTCTGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-2464s1c1
Sequence:CCGGGATGAGGACAAGAAGAGCAAACTCGAGTTTGCTCTTCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2342s1c1
Sequence:CCGGCCATTAGCTTCATGGTGGTTTCTCGAGAAACCACCATGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-867s1c1
Sequence:CCGGGCACAAGTACGATTGTAAGATCTCGAGATCTTACAATCGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2394s1c1
Sequence:CCGGCTGGGTCAACAGGTTACATTTCTCGAGAAATGTAACCTGTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-3294s1c1
Sequence:CCGGGCATCTGCAAGAGATCAACATCTCGAGATGTTGATCTCTTGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-1546s1c1
Sequence:CCGGCCACAGTTCATACTCCTGCTTCTCGAGAAGCAGGAGTATGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018125
ARHGEF10L MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 10-like
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1769s21c1
Sequence:CCGGTGCTCCTGTGTGAGACGTTGACTCGAGTCAACGTCTCACACAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-505s21c1
Sequence:CCGGCGCATTGACCGGTTCACTTTCCTCGAGGAAAGTGAACCGGTCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-2740s21c1
Sequence:CCGGGTGCTCTGCATGGAGTATATCCTCGAGGATATACTCCATGCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1155s21c1
Sequence:CCGGGGAGTCTCTGAAGCGGATACTCTCGAGAGTATCCGCTTCAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3778s21c1
Sequence:CCGGGACGGCTCCATTTACGAGATGCTCGAGCATCTCGTAAATGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-798s21c1
Sequence:CCGGGAGATACGCCAGGACTAAGAGCTCGAGCTCTTAGTCCTGGCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018125.3-4098s21c1
Sequence:CCGGTGGACTCTCCAGAAACTACTTCTCGAGAAGTAGTTTCTGGAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3202s21c1
Sequence:CCGGAGCGTGACACACATGGTGAAGCTCGAGCTTCACCATGTGTGTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-1028s21c1
Sequence:CCGGAGGTCAGCGTTTCGGACATCACTCGAGTGATGTCCGAAACGCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-3980s21c1
Sequence:CCGGAGGTGCCCTTGATGCTATAGCCTCGAGGCTATAGCATCAAGGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018125.3-258s21c1
Sequence:CCGGGGCGTTTGAGTTTGATGACAGCTCGAGCTGTCATCAAACTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2076s1c1
Sequence:CCGGGCAGGCTCAGAATAAGGTGTACTCGAGTACACCTTATTCTGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-2464s1c1
Sequence:CCGGGATGAGGACAAGAAGAGCAAACTCGAGTTTGCTCTTCTTGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2342s1c1
Sequence:CCGGCCATTAGCTTCATGGTGGTTTCTCGAGAAACCACCATGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-867s1c1
Sequence:CCGGGCACAAGTACGATTGTAAGATCTCGAGATCTTACAATCGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-2394s1c1
Sequence:CCGGCTGGGTCAACAGGTTACATTTCTCGAGAAATGTAACCTGTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018125.2-3294s1c1
Sequence:CCGGGCATCTGCAAGAGATCAACATCTCGAGATGTTGATCTCTTGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018125.2-1546s1c1
Sequence:CCGGCCACAGTTCATACTCCTGCTTCTCGAGAAGCAGGAGTATGAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172415
VALIDATED
ARHGEF10L MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 10-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-2398s1c1
Sequence:CCGGCTTGGCAAAGATTGGACTAAGCTCGAGCTTAGTCCAATCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-1369s1c1
Sequence:CCGGGTCCATGGTCCTAGATGTATACTCGAGTATACATCTAGGACCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-1380s21c1
Sequence:CCGGTAGATGTATACAGCGACTATGCTCGAGCATAGTCGCTGTATACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-1181s21c1
Sequence:CCGGGATTACCGTAACCCACTAATGCTCGAGCATTAGTGGGTTACGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-4282s21c1
Sequence:CCGGACTGCCTGCTGAACCTAGAACCTCGAGGTTCTAGGTTCAGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-3880s21c1
Sequence:CCGGTGGACAAGGCTACCGCCATTTCTCGAGAAATGGCGGTAGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-3125s21c1
Sequence:CCGGGTACTAGATGCCGCCACTTTGCTCGAGCAAAGTGGCGGCATCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.2-2711s1c1
Sequence:CCGGCCTGTGCTCTGCATAGAGTATCTCGAGATACTCTATGCAGAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172415
VALIDATED
ARHGEF10L MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 10-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-2398s1c1
Sequence:CCGGCTTGGCAAAGATTGGACTAAGCTCGAGCTTAGTCCAATCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-1369s1c1
Sequence:CCGGGTCCATGGTCCTAGATGTATACTCGAGTATACATCTAGGACCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-1380s21c1
Sequence:CCGGTAGATGTATACAGCGACTATGCTCGAGCATAGTCGCTGTATACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-1181s21c1
Sequence:CCGGGATTACCGTAACCCACTAATGCTCGAGCATTAGTGGGTTACGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-4282s21c1
Sequence:CCGGACTGCCTGCTGAACCTAGAACCTCGAGGTTCTAGGTTCAGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-3880s21c1
Sequence:CCGGTGGACAAGGCTACCGCCATTTCTCGAGAAATGGCGGTAGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-3125s21c1
Sequence:CCGGGTACTAGATGCCGCCACTTTGCTCGAGCAAAGTGGCGGCATCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.2-2711s1c1
Sequence:CCGGCCTGTGCTCTGCATAGAGTATCTCGAGATACTCTATGCAGAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172415
VALIDATED
ARHGEF10L MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 10-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-2398s1c1
Sequence:CCGGCTTGGCAAAGATTGGACTAAGCTCGAGCTTAGTCCAATCTTTGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.3-1369s1c1
Sequence:CCGGGTCCATGGTCCTAGATGTATACTCGAGTATACATCTAGGACCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-1380s21c1
Sequence:CCGGTAGATGTATACAGCGACTATGCTCGAGCATAGTCGCTGTATACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-1181s21c1
Sequence:CCGGGATTACCGTAACCCACTAATGCTCGAGCATTAGTGGGTTACGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-4282s21c1
Sequence:CCGGACTGCCTGCTGAACCTAGAACCTCGAGGTTCTAGGTTCAGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172415.3-3880s21c1
Sequence:CCGGTGGACAAGGCTACCGCCATTTCTCGAGAAATGGCGGTAGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172415.3-3125s21c1
Sequence:CCGGGTACTAGATGCCGCCACTTTGCTCGAGCAAAGTGGCGGCATCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172415.2-2711s1c1
Sequence:CCGGCCTGTGCTCTGCATAGAGTATCTCGAGATACTCTATGCAGAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks