EMAIL THIS PAGE TO A FRIEND

ARHGEF11

Rho guanine nucleotide exchange factor (GEF) 11

112 Gene Product Result for
Synonyms: GTRAP48 PDZ-RHOGEF
UniProtKB ID: O15085, D3DVD0, Q5VY40, Q6PFW2
Gene ID:
Human(9826) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(213498) Rho guanine nucleotide exchange factor (GEF) 11
Rat(78966) Rho guanine nucleotide exchange factor (GEF) 11
sheep(101110561) Rho guanine nucleotide exchange factor (GEF) 11
Domestic Rabbit(100337815) Rho guanine nucleotide exchange factor (GEF) 11
naked mole-rat(101726165) Rho guanine nucleotide exchange factor (GEF) 11
domestic guinea pig(100717118) Rho guanine nucleotide exchange factor (GEF) 11
Zebrafish(565268) Rho guanine nucleotide exchange factor (GEF) 11
domestic cat(101080861) Rho guanine nucleotide exchange factor (GEF) 11
dog(490402) Rho guanine nucleotide exchange factor (GEF) 11
chicken(425979) Rho guanine nucleotide exchange factor (GEF) 11
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014784 Rosetta Predictions human pricing
NM_198236 Rosetta Predictions human pricing
NM_023982 Rosetta Predictions rat pricing
NM_001003912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113112 predicted 3545
2 SASI_Hs01_00113114 predicted 2221
3 SASI_Hs02_00346284 predicted 3257
4 SASI_Hs02_00346285 predicted 4144
5 SASI_Hs01_00113116 predicted 4034
6 SASI_Hs01_00113117 predicted 5302
7 SASI_Hs01_00113118 predicted 2728
8 SASI_Hs01_00113120 predicted 1282
9 SASI_Hs01_00113121 predicted 5343
10 SASI_Hs02_00346286 predicted 3307
11 SASI_Hs01_00113113 predicted 1060
12 SASI_Hs01_00113115 predicted 1360
13 SASI_Hs01_00113119 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070423 predicted 3661
2 SASI_Hs01_00070425 predicted 2335
3 SASI_Hs02_00371761 predicted 3379
4 SASI_Hs02_00371762 predicted 4270
5 SASI_Hs01_00070427 predicted 4153
6 SASI_Hs01_00070428 predicted 5425
7 SASI_Hs01_00070429 predicted 2841
8 SASI_Hs01_00070431 predicted 1283
9 SASI_Hs01_00070432 predicted 5458
10 SASI_Hs02_00371763 predicted 3427
11 SASI_Hs01_00070424 predicted 1055
12 SASI_Hs01_00070426 predicted 1365
13 SASI_Hs01_00070430 predicted 3014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068889 predicted 1715
2 SASI_Rn01_00068890 predicted 275
3 SASI_Rn01_00068891 predicted 3842
4 SASI_Rn01_00068892 predicted 2509
5 SASI_Rn01_00068894 predicted 4308
6 SASI_Rn02_00263805 predicted 1880
7 SASI_Rn01_00068895 predicted 2292
8 SASI_Rn02_00263806 predicted 3365
9 SASI_Rn01_00068896 predicted 296
10 SASI_Rn01_00068897 predicted 2499
11 SASI_Rn01_00068893 predicted 1428
12 SASI_Rn01_00068898 predicted 4279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286353 predicted 1173
2 SASI_Mm01_00149861 predicted 3865
3 SASI_Mm01_00149862 predicted 583
4 SASI_Mm01_00149863 predicted 2590
5 SASI_Mm01_00149864 predicted 1492
6 SASI_Mm01_00149865 predicted 629
7 SASI_Mm01_00149867 predicted 699
8 SASI_Mm01_00149868 predicted 4354
9 SASI_Mm01_00149869 predicted 328
10 SASI_Mm02_00286354 predicted 2570
11 SASI_Mm01_00149866 predicted 1035
12 SASI_Mm01_00149870 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003912
ARHGEF11 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003912.1-5007s1c1
Sequence:CCGGGCCCTTTAGTTTCCTATAAATCTCGAGATTTATAGGAAACTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-1091s1c1
Sequence:CCGGCCAGCTTACTTGGTAGTATTTCTCGAGAAATACTACCAAGTAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-4037s1c1
Sequence:CCGGGCAGGAAGTTACAAAGTTGTACTCGAGTACAACTTTGTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-542s1c1
Sequence:CCGGGCCACTCAAATCCTCAGGAATCTCGAGATTCCTGAGGATTTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-3450s1c1
Sequence:CCGGCGGAAGTGTATCCCACTGAAACTCGAGTTTCAGTGGGATACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003912
ARHGEF11 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003912.1-5007s1c1
Sequence:CCGGGCCCTTTAGTTTCCTATAAATCTCGAGATTTATAGGAAACTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-1091s1c1
Sequence:CCGGCCAGCTTACTTGGTAGTATTTCTCGAGAAATACTACCAAGTAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-4037s1c1
Sequence:CCGGGCAGGAAGTTACAAAGTTGTACTCGAGTACAACTTTGTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-542s1c1
Sequence:CCGGGCCACTCAAATCCTCAGGAATCTCGAGATTCCTGAGGATTTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-3450s1c1
Sequence:CCGGCGGAAGTGTATCCCACTGAAACTCGAGTTTCAGTGGGATACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003912
ARHGEF11 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003912.1-5007s1c1
Sequence:CCGGGCCCTTTAGTTTCCTATAAATCTCGAGATTTATAGGAAACTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-1091s1c1
Sequence:CCGGCCAGCTTACTTGGTAGTATTTCTCGAGAAATACTACCAAGTAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-4037s1c1
Sequence:CCGGGCAGGAAGTTACAAAGTTGTACTCGAGTACAACTTTGTAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-542s1c1
Sequence:CCGGGCCACTCAAATCCTCAGGAATCTCGAGATTCCTGAGGATTTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003912.1-3450s1c1
Sequence:CCGGCGGAAGTGTATCCCACTGAAACTCGAGTTTCAGTGGGATACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014784
VALIDATED
ARHGEF11 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014784.2-5941s1c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-2636s1c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-3914s1c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014784.2-3311s1c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-1298s21c1
Sequence:CCGGCGACCGGATCATCAAAGTCAACTCGAGTTGACTTTGATGATCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3914s21c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3311s21c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-2636s21c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014784.2-5941s21c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014784
VALIDATED
ARHGEF11 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014784.2-5941s1c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-2636s1c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-3914s1c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014784.2-3311s1c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-1298s21c1
Sequence:CCGGCGACCGGATCATCAAAGTCAACTCGAGTTGACTTTGATGATCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3914s21c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3311s21c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-2636s21c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014784.2-5941s21c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014784
VALIDATED
ARHGEF11 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014784.2-5941s1c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-2636s1c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014784.2-3914s1c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014784.2-3311s1c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-1298s21c1
Sequence:CCGGCGACCGGATCATCAAAGTCAACTCGAGTTGACTTTGATGATCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3914s21c1
Sequence:CCGGCCTGGATCTTACAACCAGAAACTCGAGTTTCTGGTTGTAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-3311s21c1
Sequence:CCGGCCTGATCTTCTACCAGCGAATCTCGAGATTCGCTGGTAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014784.2-2636s21c1
Sequence:CCGGGCGAAACCCTATCCTCAAATACTCGAGTATTTGAGGATAGGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014784.2-5941s21c1
Sequence:CCGGCCCTCAGACATGCAAGTGAAACTCGAGTTTCACTTGCATGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks