EMAIL THIS PAGE TO A FRIEND

ARHGEF15

Rho guanine nucleotide exchange factor (GEF) 15

200 Gene Product Result for
Synonyms: ARGEF15 E5 Ephexin5 Vsm-RhoGEF
UniProtKB ID: O94989, A8K6G1, Q8N449, Q9H8B4
Gene ID:
Human(22899) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
Mouse(442801) Rho guanine nucleotide exchange factor (GEF) 15
Rat(287418) Rho guanine nucleotide exchange factor (GEF) 15
sheep(101107803) Rho guanine nucleotide exchange factor (GEF) 15
Domestic Rabbit(100350440) Rho guanine nucleotide exchange factor (GEF) 15
naked mole-rat(101715980) Rho guanine nucleotide exchange factor (GEF) 15
domestic guinea pig(100730612) Rho guanine nucleotide exchange factor (GEF) 15
dog(489492) Rho guanine nucleotide exchange factor (GEF) 15
domestic cat(101081090) Rho guanine nucleotide exchange factor (GEF) 15
Horse(100073056) Rho guanine nucleotide exchange factor (GEF) 15
cow(512021) Rho guanine nucleotide exchange factor (GEF) 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173728 Rosetta Predictions human pricing
NM_001105789 Rosetta Predictions rat pricing
NM_177566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040677 predicted 2366
2 SASI_Hs02_00368643 predicted 1625
3 SASI_Hs01_00040678 predicted 1065
4 SASI_Hs01_00040679 predicted 2095
5 SASI_Hs01_00040680 predicted 1478
6 SASI_Hs01_00040681 predicted 2140
7 SASI_Hs01_00040682 predicted 2157
8 SASI_Hs02_00368644 predicted 1925
9 SASI_Hs01_00040683 predicted 2132
10 SASI_Hs01_00040685 predicted 1063
11 SASI_Hs01_00040684 predicted 2393
12 SASI_Hs01_00040686 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212546 predicted 229
2 SASI_Rn02_00212547 predicted 849
3 SASI_Rn02_00212548 predicted 1916
4 SASI_Rn02_00212549 predicted 244
5 SASI_Rn02_00212550 predicted 822
6 SASI_Rn02_00212551 predicted 1651
7 SASI_Rn02_00212552 predicted 923
8 SASI_Rn02_00212553 predicted 705
9 SASI_Rn02_00212554 predicted 1603
10 SASI_Rn02_00212555 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104831 predicted 1635
2 SASI_Mm01_00104832 predicted 814
3 SASI_Mm01_00104833 predicted 2337
4 SASI_Mm01_00104834 predicted 2347
5 SASI_Mm01_00104835 predicted 913
6 SASI_Mm01_00104836 predicted 2426
7 SASI_Mm01_00104837 predicted 842
8 SASI_Mm01_00104838 predicted 1896
9 SASI_Mm01_00104839 predicted 1626
10 SASI_Mm01_00104840 predicted 1592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173728
ARHGEF15 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-2162s1c1
Sequence:CCGGCGGTTACAGGTTCTGGACTATCTCGAGATAGTCCAGAACCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1019s1c1
Sequence:CCGGGATCTTGATCTGCTTTCTGAACTCGAGTTCAGAAAGCAGATCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-264s1c1
Sequence:CCGGGAAACTCCAATGATGCACCAACTCGAGTTGGTGCATCATTGGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1639s1c1
Sequence:CCGGGTATGTGGATTATGTGCGGAACTCGAGTTCCGCACATAATCCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173728.2-1886s21c1
Sequence:CCGGGGTGCTGTCAGCAAGATCATCCTCGAGGATGATCTTGCTGACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-2910s21c1
Sequence:CCGGAGCCTATGGCCAATGAGTATTCTCGAGAATACTCATTGGCCATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-3082s21c1
Sequence:CCGGAGTAGTCACCCTGCTTGTTTCCTCGAGGAAACAAGCAGGGTGACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173728
ARHGEF15 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-2162s1c1
Sequence:CCGGCGGTTACAGGTTCTGGACTATCTCGAGATAGTCCAGAACCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1019s1c1
Sequence:CCGGGATCTTGATCTGCTTTCTGAACTCGAGTTCAGAAAGCAGATCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-264s1c1
Sequence:CCGGGAAACTCCAATGATGCACCAACTCGAGTTGGTGCATCATTGGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1639s1c1
Sequence:CCGGGTATGTGGATTATGTGCGGAACTCGAGTTCCGCACATAATCCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173728.2-1886s21c1
Sequence:CCGGGGTGCTGTCAGCAAGATCATCCTCGAGGATGATCTTGCTGACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-2910s21c1
Sequence:CCGGAGCCTATGGCCAATGAGTATTCTCGAGAATACTCATTGGCCATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-3082s21c1
Sequence:CCGGAGTAGTCACCCTGCTTGTTTCCTCGAGGAAACAAGCAGGGTGACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173728
ARHGEF15 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-2162s1c1
Sequence:CCGGCGGTTACAGGTTCTGGACTATCTCGAGATAGTCCAGAACCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1019s1c1
Sequence:CCGGGATCTTGATCTGCTTTCTGAACTCGAGTTCAGAAAGCAGATCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-264s1c1
Sequence:CCGGGAAACTCCAATGATGCACCAACTCGAGTTGGTGCATCATTGGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173728.2-1639s1c1
Sequence:CCGGGTATGTGGATTATGTGCGGAACTCGAGTTCCGCACATAATCCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173728.2-1886s21c1
Sequence:CCGGGGTGCTGTCAGCAAGATCATCCTCGAGGATGATCTTGCTGACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-2910s21c1
Sequence:CCGGAGCCTATGGCCAATGAGTATTCTCGAGAATACTCATTGGCCATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173728.2-3082s21c1
Sequence:CCGGAGTAGTCACCCTGCTTGTTTCCTCGAGGAAACAAGCAGGGTGACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177566
ARHGEF15 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 15
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.2-2044s1c1
Sequence:CCGGGCCTGGCTTTAAGATGTATTTCTCGAGAAATACATCTTAAAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-1095s1c1
Sequence:CCGGGTAGAGAAGGACTCCAGACTTCTCGAGAAGTCTGGAGTCCTTCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-734s1c1
Sequence:CCGGGTATGTGGATTATGTTCGGAACTCGAGTTCCGAACATAATCCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-717s1c1
Sequence:CCGGGTTGGTCCTTTCTTCGTGTATCTCGAGATACACGAAGAAAGGACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-985s1c1
Sequence:CCGGCTGGTGTAGTTATCACCATTTCTCGAGAAATGGTGATAACTACACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-2432s1c1
Sequence:CCGGCCGAAAGCATCTGCACAAGAACTCGAGTTCTTGTGCAGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.3-3666s1c1
Sequence:CCGGCCCGACTTGAATTGTCATCATCTCGAGATGATGACAATTCAAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-966s1c1
Sequence:CCGGGATCTGAAACTGCCTTCAGAACTCGAGTTCTGAAGGCAGTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-1775s1c1
Sequence:CCGGGCGGATGCTGTTGCAGAATATCTCGAGATATTCTGCAACAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1629s1c1
Sequence:CCGGCAGTATCAGGAGGAGACCTATCTCGAGATAGGTCTCCTCCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1137s1c1
Sequence:CCGGCCTTTATACCAGACTTACCGACTCGAGTCGGTAAGTCTGGTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-189s1c1
Sequence:CCGGCCGAAAGCACTTCCTCAAATACTCGAGTATTTGAGGAAGTGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177566
ARHGEF15 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 15
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.2-2044s1c1
Sequence:CCGGGCCTGGCTTTAAGATGTATTTCTCGAGAAATACATCTTAAAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-1095s1c1
Sequence:CCGGGTAGAGAAGGACTCCAGACTTCTCGAGAAGTCTGGAGTCCTTCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-734s1c1
Sequence:CCGGGTATGTGGATTATGTTCGGAACTCGAGTTCCGAACATAATCCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-717s1c1
Sequence:CCGGGTTGGTCCTTTCTTCGTGTATCTCGAGATACACGAAGAAAGGACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-985s1c1
Sequence:CCGGCTGGTGTAGTTATCACCATTTCTCGAGAAATGGTGATAACTACACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-2432s1c1
Sequence:CCGGCCGAAAGCATCTGCACAAGAACTCGAGTTCTTGTGCAGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.3-3666s1c1
Sequence:CCGGCCCGACTTGAATTGTCATCATCTCGAGATGATGACAATTCAAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-966s1c1
Sequence:CCGGGATCTGAAACTGCCTTCAGAACTCGAGTTCTGAAGGCAGTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-1775s1c1
Sequence:CCGGGCGGATGCTGTTGCAGAATATCTCGAGATATTCTGCAACAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1629s1c1
Sequence:CCGGCAGTATCAGGAGGAGACCTATCTCGAGATAGGTCTCCTCCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1137s1c1
Sequence:CCGGCCTTTATACCAGACTTACCGACTCGAGTCGGTAAGTCTGGTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-189s1c1
Sequence:CCGGCCGAAAGCACTTCCTCAAATACTCGAGTATTTGAGGAAGTGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177566
ARHGEF15 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 15
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.2-2044s1c1
Sequence:CCGGGCCTGGCTTTAAGATGTATTTCTCGAGAAATACATCTTAAAGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-1095s1c1
Sequence:CCGGGTAGAGAAGGACTCCAGACTTCTCGAGAAGTCTGGAGTCCTTCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-734s1c1
Sequence:CCGGGTATGTGGATTATGTTCGGAACTCGAGTTCCGAACATAATCCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-717s1c1
Sequence:CCGGGTTGGTCCTTTCTTCGTGTATCTCGAGATACACGAAGAAAGGACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.2-985s1c1
Sequence:CCGGCTGGTGTAGTTATCACCATTTCTCGAGAAATGGTGATAACTACACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-2432s1c1
Sequence:CCGGCCGAAAGCATCTGCACAAGAACTCGAGTTCTTGTGCAGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177566.3-3666s1c1
Sequence:CCGGCCCGACTTGAATTGTCATCATCTCGAGATGATGACAATTCAAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-966s1c1
Sequence:CCGGGATCTGAAACTGCCTTCAGAACTCGAGTTCTGAAGGCAGTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-1775s1c1
Sequence:CCGGGCGGATGCTGTTGCAGAATATCTCGAGATATTCTGCAACAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1629s1c1
Sequence:CCGGCAGTATCAGGAGGAGACCTATCTCGAGATAGGTCTCCTCCTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177566.3-1137s1c1
Sequence:CCGGCCTTTATACCAGACTTACCGACTCGAGTCGGTAAGTCTGGTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177566.3-189s1c1
Sequence:CCGGCCGAAAGCACTTCCTCAAATACTCGAGTATTTGAGGAAGTGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks