EMAIL THIS PAGE TO A FRIEND

ARHGEF16

Rho guanine nucleotide exchange factor (GEF) 16

58 Gene Product Result for
Synonyms: GEF16 NBR
UniProtKB ID: Q5VV41, Q86TF0, Q99434
Gene ID:
Human(27237) Summary: Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Mouse(230972) Rho guanine nucleotide exchange factor (GEF) 16
Rat(687105) Rho guanine nucleotide exchange factor (GEF) 16
Zebrafish(567180) Rho guanine nucleotide exchange factor (GEF) 16
chicken(419386) Rho guanine nucleotide exchange factor (GEF) 16
cow(514453) Rho guanine nucleotide exchange factor (GEF) 16
Horse(100060769) Rho guanine nucleotide exchange factor (GEF) 16
domestic cat(101087499) Rho guanine nucleotide exchange factor (GEF) 16
dog(607691) Rho guanine nucleotide exchange factor (GEF) 16
domestic guinea pig(100728532) Rho guanine nucleotide exchange factor (GEF) 16
naked mole-rat(101719690) Rho guanine nucleotide exchange factor (GEF) 16
sheep(101119743) Rho guanine nucleotide exchange factor (GEF) 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001112744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001112744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001112744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119751 MISSION® esiRNA esiRNA human ARHGEF16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014448 Rosetta Predictions human pricing
NM_001127591 Rosetta Predictions rat pricing
NM_001112744 Rosetta Predictions mouse pricing
XM_902459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345657 predicted 478
2 SASI_Hs02_00345658 predicted 450
3 SASI_Hs02_00345659 predicted 991
4 SASI_Hs01_00025897 predicted 2288
5 SASI_Hs01_00025898 predicted 1757
6 SASI_Hs01_00025899 predicted 1675
7 SASI_Hs02_00345660 predicted 490
8 SASI_Hs01_00025900 predicted 1238
9 SASI_Hs01_00025901 predicted 1876
10 SASI_Hs01_00025902 predicted 2181
11 SASI_Hs01_00025903 predicted 838
12 SASI_Hs01_00025904 predicted 658
13 SASI_Hs01_00025905 predicted 545
14 SASI_Hs01_00025906 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254560 predicted 757
2 SASI_Rn02_00254561 predicted 756
3 SASI_Rn02_00254562 predicted 892
4 SASI_Rn02_00254563 predicted 811
5 SASI_Rn02_00254564 predicted 1267
6 SASI_Rn02_00254565 predicted 1893
7 SASI_Rn02_00254566 predicted 605
8 SASI_Rn02_00254567 predicted 1058
9 SASI_Rn02_00254568 predicted 1442
10 SASI_Rn02_00254569 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307093 predicted 2027
2 SASI_Mm02_00307094 predicted 230
3 SASI_Mm02_00307095 predicted 1086
4 SASI_Mm02_00307096 predicted 2053
5 SASI_Mm02_00307097 predicted 767
6 SASI_Mm02_00307098 predicted 1669
7 SASI_Mm02_00307099 predicted 1051
8 SASI_Mm02_00307100 predicted 975
9 SASI_Mm02_00307101 predicted 932
10 SASI_Mm02_00307102 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242572 predicted 2377
2 SASI_Mm01_00242573 predicted 577
3 SASI_Mm01_00242574 predicted 2394
4 SASI_Mm01_00242575 predicted 1111
5 SASI_Mm01_00242576 predicted 2018
6 SASI_Mm01_00242577 predicted 1393
7 SASI_Mm01_00242578 predicted 1314
8 SASI_Mm01_00242579 predicted 1274
9 SASI_Mm01_00242580 predicted 467
10 SASI_Mm01_00242581 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014448
VALIDATED
ARHGEF16 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-2712s21c1
Sequence:CCGGGAGGCACCAATAGCGATTATTCTCGAGAATAATCGCTATTGGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-941s21c1
Sequence:CCGGTGACGACATCCTCGATGAGTCCTCGAGGACTCATCGAGGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-501s21c1
Sequence:CCGGACCCAACAGCTGATCCCTAAGCTCGAGCTTAGGGATCAGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-1700s21c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-1120s21c1
Sequence:CCGGAGATCCTCACGTCGGAGTTCTCTCGAGAGAACTCCGACGTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-691s1c1
Sequence:CCGGGCAGAAGCTGATAAGCAGCAACTCGAGTTGCTGCTTATCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1047s1c1
Sequence:CCGGAGCTGTTCTTAGTGGAAGAAACTCGAGTTTCTTCCACTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1202s1c1
Sequence:CCGGGTAGAGAAGATAGAGCCGTCTCTCGAGAGACGGCTCTATCTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-979s1c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1636s1c1
Sequence:CCGGGCGGGTGGAGACGGACGTGTACTCGAGTACACGTCCGTCTCCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014448
VALIDATED
ARHGEF16 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-2712s21c1
Sequence:CCGGGAGGCACCAATAGCGATTATTCTCGAGAATAATCGCTATTGGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-941s21c1
Sequence:CCGGTGACGACATCCTCGATGAGTCCTCGAGGACTCATCGAGGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-501s21c1
Sequence:CCGGACCCAACAGCTGATCCCTAAGCTCGAGCTTAGGGATCAGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-1700s21c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-1120s21c1
Sequence:CCGGAGATCCTCACGTCGGAGTTCTCTCGAGAGAACTCCGACGTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-691s1c1
Sequence:CCGGGCAGAAGCTGATAAGCAGCAACTCGAGTTGCTGCTTATCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1047s1c1
Sequence:CCGGAGCTGTTCTTAGTGGAAGAAACTCGAGTTTCTTCCACTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1202s1c1
Sequence:CCGGGTAGAGAAGATAGAGCCGTCTCTCGAGAGACGGCTCTATCTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-979s1c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1636s1c1
Sequence:CCGGGCGGGTGGAGACGGACGTGTACTCGAGTACACGTCCGTCTCCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014448
VALIDATED
ARHGEF16 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-2712s21c1
Sequence:CCGGGAGGCACCAATAGCGATTATTCTCGAGAATAATCGCTATTGGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-941s21c1
Sequence:CCGGTGACGACATCCTCGATGAGTCCTCGAGGACTCATCGAGGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-501s21c1
Sequence:CCGGACCCAACAGCTGATCCCTAAGCTCGAGCTTAGGGATCAGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014448.3-1700s21c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014448.3-1120s21c1
Sequence:CCGGAGATCCTCACGTCGGAGTTCTCTCGAGAGAACTCCGACGTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-691s1c1
Sequence:CCGGGCAGAAGCTGATAAGCAGCAACTCGAGTTGCTGCTTATCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1047s1c1
Sequence:CCGGAGCTGTTCTTAGTGGAAGAAACTCGAGTTTCTTCCACTAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1202s1c1
Sequence:CCGGGTAGAGAAGATAGAGCCGTCTCTCGAGAGACGGCTCTATCTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-979s1c1
Sequence:CCGGGCTGGACTTCAGCAAGGTCAACTCGAGTTGACCTTGCTGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014448.2-1636s1c1
Sequence:CCGGGCGGGTGGAGACGGACGTGTACTCGAGTACACGTCCGTCTCCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001112744
ARHGEF16 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1231s21c1
Sequence:CCGGACTGCTCCAACGAGGTCTATCCTCGAGGATAGACCTCGTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112744.1-2366s21c1
Sequence:CCGGGCAGAACACTGAACATCTATACTCGAGTATAGATGTTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-784s21c1
Sequence:CCGGACGAGTCCGATGATGACATTCCTCGAGGAATGTCATCATCGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1518s21c1
Sequence:CCGGGAGCGCACAGAGCAGATATACCTCGAGGTATATCTGCTCTGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1428s21c1
Sequence:CCGGGGCCATCCCGAACGGTATAAACTCGAGTTTATACCGTTCGGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001112744
ARHGEF16 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1231s21c1
Sequence:CCGGACTGCTCCAACGAGGTCTATCCTCGAGGATAGACCTCGTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112744.1-2366s21c1
Sequence:CCGGGCAGAACACTGAACATCTATACTCGAGTATAGATGTTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-784s21c1
Sequence:CCGGACGAGTCCGATGATGACATTCCTCGAGGAATGTCATCATCGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1518s21c1
Sequence:CCGGGAGCGCACAGAGCAGATATACCTCGAGGTATATCTGCTCTGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1428s21c1
Sequence:CCGGGGCCATCCCGAACGGTATAAACTCGAGTTTATACCGTTCGGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001112744
ARHGEF16 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1231s21c1
Sequence:CCGGACTGCTCCAACGAGGTCTATCCTCGAGGATAGACCTCGTTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112744.1-2366s21c1
Sequence:CCGGGCAGAACACTGAACATCTATACTCGAGTATAGATGTTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-784s21c1
Sequence:CCGGACGAGTCCGATGATGACATTCCTCGAGGAATGTCATCATCGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1518s21c1
Sequence:CCGGGAGCGCACAGAGCAGATATACCTCGAGGTATATCTGCTCTGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112744.1-1428s21c1
Sequence:CCGGGGCCATCCCGAACGGTATAAACTCGAGTTTATACCGTTCGGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks