EMAIL THIS PAGE TO A FRIEND

ARHGEF17

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms: P164RHOGEF TEM4 p164-RhoGEF
UniProtKB ID: Q96PE2, B2RP20, Q86XU2, Q8N2S0, Q9Y4G3
Gene ID:
Mouse(207212) Rho guanine nucleotide exchange factor (GEF) 17
Rat(308862) Rho guanine nucleotide exchange factor (GEF) 17
sheep(101104090) Rho guanine nucleotide exchange factor (GEF) 17
naked mole-rat(101719107) Rho guanine nucleotide exchange factor (GEF) 17
domestic guinea pig(100735985) Rho guanine nucleotide exchange factor (GEF) 17
Zebrafish(335662) Rho guanine nucleotide exchange factor (GEF) 17
chicken(419067) Rho guanine nucleotide exchange factor (GEF) 17
cow(540026) Rho guanine nucleotide exchange factor (GEF) 17
cow(100336675) Rho guanine nucleotide exchange factor (GEF) 17
Horse(100065731) Rho guanine nucleotide exchange factor (GEF) 17
domestic cat(101081922) Rho guanine nucleotide exchange factor (GEF) 17
dog(485201) Rho guanine nucleotide exchange factor (GEF) 17
Gene Class: Cytoskeleton
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0741 AQUA Peptide EWGSGSDTL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014786 Rosetta Predictions human pricing
NM_001107538 Rosetta Predictions rat pricing
NM_001081116 Rosetta Predictions mouse pricing
XM_133692 Rosetta Predictions mouse pricing
XM_898398 Rosetta Predictions mouse pricing
XM_992030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223653 predicted 2395
2 SASI_Hs01_00223654 predicted 938
3 SASI_Hs01_00223655 predicted 943
4 SASI_Hs01_00223656 predicted 645
5 SASI_Hs01_00223657 predicted 6271
6 SASI_Hs01_00223658 predicted 6088
7 SASI_Hs01_00223659 predicted 6104
8 SASI_Hs01_00223660 predicted 2375
9 SASI_Hs01_00223661 predicted 3494
10 SASI_Hs01_00223662 predicted 3280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229815 predicted 2820
2 SASI_Rn02_00229816 predicted 2269
3 SASI_Rn02_00229817 predicted 2871
4 SASI_Rn02_00229818 predicted 3435
5 SASI_Rn02_00229819 predicted 3456
6 SASI_Rn02_00229820 predicted 3454
7 SASI_Rn02_00229821 predicted 2983
8 SASI_Rn02_00229822 predicted 3285
9 SASI_Rn02_00229823 predicted 2486
10 SASI_Rn02_00229824 predicted 3998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295341 predicted 3234
2 SASI_Mm02_00295342 predicted 1937
3 SASI_Mm02_00295343 predicted 3417
4 SASI_Mm02_00295344 predicted 3877
5 SASI_Mm02_00295345 predicted 2777
6 SASI_Mm02_00295346 predicted 3402
7 SASI_Mm02_00295347 predicted 3849
8 SASI_Mm02_00295348 predicted 1472
9 SASI_Mm02_00295349 predicted 5146
10 SASI_Mm02_00295350 predicted 2541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275540 predicted 3241
2 SASI_Mm01_00275541 predicted 1937
3 SASI_Mm01_00275542 predicted 3421
4 SASI_Mm01_00275543 predicted 3877
5 SASI_Mm01_00275544 predicted 2782
6 SASI_Mm01_00275545 predicted 3406
7 SASI_Mm01_00275546 predicted 4278
8 SASI_Mm01_00275547 predicted 3858
9 SASI_Mm01_00275548 predicted 1479
10 SASI_Mm01_00275549 predicted 5151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252178 predicted 577
2 SASI_Mm01_00252179 predicted 743
3 SASI_Mm01_00252180 predicted 2738
4 SASI_Mm01_00252181 predicted 971
5 SASI_Mm01_00252182 predicted 555
6 SASI_Mm01_00252183 predicted 1852
7 SASI_Mm01_00252184 predicted 3049
8 SASI_Mm01_00252185 predicted 2755
9 SASI_Mm01_00252186 predicted 1005
10 SASI_Mm01_00252187 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263854 predicted 1038
2 SASI_Mm01_00263855 predicted 1221
3 SASI_Mm01_00263856 predicted 1675
4 SASI_Mm01_00263857 predicted 578
5 SASI_Mm01_00263858 predicted 1204
6 SASI_Mm01_00263859 predicted 2077
7 SASI_Mm01_00263860 predicted 1087
8 SASI_Mm01_00263861 predicted 2225
9 SASI_Mm01_00263862 predicted 1657
10 SASI_Mm01_00263863 predicted 2951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014786
ARHGEF17 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2902s1c1
Sequence:CCGGCCCGCCACATTTATGCCTATTCTCGAGAATAGGCATAAATGTGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2407s1c1
Sequence:CCGGGAGGTTATTCAGAGCATAGTTCTCGAGAACTATGCTCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-5349s1c1
Sequence:CCGGGTATCTGAATAACCAGGTGTTCTCGAGAACACCTGGTTATTCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-951s1c1
Sequence:CCGGGTTAAATCTAAGCAGCATGAACTCGAGTTCATGCTGCTTAGATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-3562s1c1
Sequence:CCGGCCTGCCTTTCTCAAGTTCCTACTCGAGTAGGAACTTGAGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-1394s21c1
Sequence:CCGGAGCGGAAGTCCCTGTCAAATCCTCGAGGATTTGACAGGGACTTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-3501s21c1
Sequence:CCGGCTATTCTGCCTATATCGATAACTCGAGTTATCGATATAGGCAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014786
ARHGEF17 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2902s1c1
Sequence:CCGGCCCGCCACATTTATGCCTATTCTCGAGAATAGGCATAAATGTGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2407s1c1
Sequence:CCGGGAGGTTATTCAGAGCATAGTTCTCGAGAACTATGCTCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-5349s1c1
Sequence:CCGGGTATCTGAATAACCAGGTGTTCTCGAGAACACCTGGTTATTCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-951s1c1
Sequence:CCGGGTTAAATCTAAGCAGCATGAACTCGAGTTCATGCTGCTTAGATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-3562s1c1
Sequence:CCGGCCTGCCTTTCTCAAGTTCCTACTCGAGTAGGAACTTGAGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-1394s21c1
Sequence:CCGGAGCGGAAGTCCCTGTCAAATCCTCGAGGATTTGACAGGGACTTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-3501s21c1
Sequence:CCGGCTATTCTGCCTATATCGATAACTCGAGTTATCGATATAGGCAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014786
ARHGEF17 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2902s1c1
Sequence:CCGGCCCGCCACATTTATGCCTATTCTCGAGAATAGGCATAAATGTGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-2407s1c1
Sequence:CCGGGAGGTTATTCAGAGCATAGTTCTCGAGAACTATGCTCTGAATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-5349s1c1
Sequence:CCGGGTATCTGAATAACCAGGTGTTCTCGAGAACACCTGGTTATTCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-951s1c1
Sequence:CCGGGTTAAATCTAAGCAGCATGAACTCGAGTTCATGCTGCTTAGATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014786.2-3562s1c1
Sequence:CCGGCCTGCCTTTCTCAAGTTCCTACTCGAGTAGGAACTTGAGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-1394s21c1
Sequence:CCGGAGCGGAAGTCCCTGTCAAATCCTCGAGGATTTGACAGGGACTTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014786.3-3501s21c1
Sequence:CCGGCTATTCTGCCTATATCGATAACTCGAGTTATCGATATAGGCAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081116
ARHGEF17 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-1564s21c1
Sequence:CCGGCCCGAGGAAGTAGTCGCTATTCTCGAGAATAGCGACTACTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-2152s21c1
Sequence:CCGGTCGTGGTCCAGGATCAGTATGCTCGAGCATACTGATCCTGGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-453s21c1
Sequence:CCGGTATCGCAGCGTCTCGTTTAAACTCGAGTTTAAACGAGACGCTGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-3875s21c1
Sequence:CCGGGAACATCTATTCGGCCTATATCTCGAGATATAGGCCGAATAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081116.1-8757s21c1
Sequence:CCGGATGATGATATGTGCCTATAATCTCGAGATTATAGGCACATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081116
ARHGEF17 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-1564s21c1
Sequence:CCGGCCCGAGGAAGTAGTCGCTATTCTCGAGAATAGCGACTACTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-2152s21c1
Sequence:CCGGTCGTGGTCCAGGATCAGTATGCTCGAGCATACTGATCCTGGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-453s21c1
Sequence:CCGGTATCGCAGCGTCTCGTTTAAACTCGAGTTTAAACGAGACGCTGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-3875s21c1
Sequence:CCGGGAACATCTATTCGGCCTATATCTCGAGATATAGGCCGAATAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081116.1-8757s21c1
Sequence:CCGGATGATGATATGTGCCTATAATCTCGAGATTATAGGCACATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081116
ARHGEF17 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-1564s21c1
Sequence:CCGGCCCGAGGAAGTAGTCGCTATTCTCGAGAATAGCGACTACTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-2152s21c1
Sequence:CCGGTCGTGGTCCAGGATCAGTATGCTCGAGCATACTGATCCTGGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-453s21c1
Sequence:CCGGTATCGCAGCGTCTCGTTTAAACTCGAGTTTAAACGAGACGCTGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081116.1-3875s21c1
Sequence:CCGGGAACATCTATTCGGCCTATATCTCGAGATATAGGCCGAATAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081116.1-8757s21c1
Sequence:CCGGATGATGATATGTGCCTATAATCTCGAGATTATAGGCACATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks