EMAIL THIS PAGE TO A FRIEND

ARHGEF18

Rho/Rac guanine nucleotide exchange factor (GEF) 18

54 Gene Product Result for
Synonyms: P114-RhoGEF
UniProtKB ID: Q6ZSZ5, A8MV62, B5ME81, O60274, Q6DD92
Gene ID:
Human(23370) Summary: Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Mouse(102098) rho/rac guanine nucleotide exchange factor (GEF) 18
Rat(304193) rho/rac guanine nucleotide exchange factor (GEF) 18
chicken(420132) rho/rac guanine nucleotide exchange factor (GEF) 18
domestic cat(101081026) Rho/Rac guanine nucleotide exchange factor (GEF) 18
dog(484991) Rho/Rac guanine nucleotide exchange factor (GEF) 18
cow(522521) Rho/Rac guanine nucleotide exchange factor (GEF) 18
domestic guinea pig(100736199) Rho/Rac guanine nucleotide exchange factor (GEF) 18
naked mole-rat(101722983) Rho/Rac guanine nucleotide exchange factor (GEF) 18
sheep(101122356) Rho/Rac guanine nucleotide exchange factor (GEF) 18
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015318 Rosetta Predictions human pricing
NM_001107115 Rosetta Predictions rat pricing
NM_133962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234668 predicted 1372
2 SASI_Hs01_00234670 predicted 3470
3 SASI_Hs01_00234671 predicted 3345
4 SASI_Hs02_00347587 predicted 852
5 SASI_Hs01_00234672 predicted 2057
6 SASI_Hs01_00234673 predicted 962
7 SASI_Hs01_00234674 predicted 1076
8 SASI_Hs01_00234676 predicted 555
9 SASI_Hs01_00234677 predicted 975
10 SASI_Hs02_00347588 predicted 957
11 SASI_Hs01_00234669 predicted 633
12 SASI_Hs01_00234675 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225646 predicted 1810
2 SASI_Rn02_00225647 predicted 2010
3 SASI_Rn02_00225648 predicted 2646
4 SASI_Rn02_00225649 predicted 2515
5 SASI_Rn02_00225650 predicted 2512
6 SASI_Rn02_00225651 predicted 937
7 SASI_Rn02_00225652 predicted 1414
8 SASI_Rn02_00225653 predicted 1384
9 SASI_Rn02_00225654 predicted 2004
10 SASI_Rn02_00225655 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196299 predicted 1739
2 SASI_Mm01_00196300 predicted 390
3 SASI_Mm02_00339079 predicted 957
4 SASI_Mm01_00196303 predicted 312
5 SASI_Mm01_00196304 predicted 774
6 SASI_Mm01_00196305 predicted 691
7 SASI_Mm01_00196306 predicted 343
8 SASI_Mm01_00196307 predicted 2702
9 SASI_Mm02_00339080 predicted 605
10 SASI_Mm02_00339081 predicted 1407
11 SASI_Mm01_00196301 predicted 3195
12 SASI_Mm01_00196302 predicted 642
13 SASI_Mm01_00196308 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015318
ARHGEF18 MISSION shRNA Bacterial Glycerol Stock
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015318.3-3702s21c1
Sequence:CCGGTTTGGAAGCCCATCGTGAAAGCTCGAGCTTTCACGATGGGCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-959s21c1
Sequence:CCGGCCTGGTTACACAACGCATAACCTCGAGGTTATGCGTTGTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-358s21c1
Sequence:CCGGCTCCAAACACCGAGTCCATTTCTCGAGAAATGGACTCGGTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-1940s21c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-859s1c1
Sequence:CCGGCCGGAATTATGTCATCCAGAACTCGAGTTCTGGATGACATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1573s1c1
Sequence:CCGGGCCGGAGATGTATGAAATCTACTCGAGTAGATTTCATACATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1389s1c1
Sequence:CCGGGCTTGAAAGATATCCTGGCTACTCGAGTAGCCAGGATATCTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-2065s1c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-397s1c1
Sequence:CCGGCGGACCAATCACAGGAGAGATCTCGAGATCTCTCCTGTGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015318
ARHGEF18 MISSION shRNA shRNA Plasmid DNA
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015318.3-3702s21c1
Sequence:CCGGTTTGGAAGCCCATCGTGAAAGCTCGAGCTTTCACGATGGGCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-959s21c1
Sequence:CCGGCCTGGTTACACAACGCATAACCTCGAGGTTATGCGTTGTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-358s21c1
Sequence:CCGGCTCCAAACACCGAGTCCATTTCTCGAGAAATGGACTCGGTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-1940s21c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-859s1c1
Sequence:CCGGCCGGAATTATGTCATCCAGAACTCGAGTTCTGGATGACATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1573s1c1
Sequence:CCGGGCCGGAGATGTATGAAATCTACTCGAGTAGATTTCATACATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1389s1c1
Sequence:CCGGGCTTGAAAGATATCCTGGCTACTCGAGTAGCCAGGATATCTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-2065s1c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-397s1c1
Sequence:CCGGCGGACCAATCACAGGAGAGATCTCGAGATCTCTCCTGTGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015318
ARHGEF18 MISSION shRNA Lentiviral Transduction Particles
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015318.3-3702s21c1
Sequence:CCGGTTTGGAAGCCCATCGTGAAAGCTCGAGCTTTCACGATGGGCTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-959s21c1
Sequence:CCGGCCTGGTTACACAACGCATAACCTCGAGGTTATGCGTTGTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-358s21c1
Sequence:CCGGCTCCAAACACCGAGTCCATTTCTCGAGAAATGGACTCGGTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015318.3-1940s21c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-859s1c1
Sequence:CCGGCCGGAATTATGTCATCCAGAACTCGAGTTCTGGATGACATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1573s1c1
Sequence:CCGGGCCGGAGATGTATGAAATCTACTCGAGTAGATTTCATACATCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-1389s1c1
Sequence:CCGGGCTTGAAAGATATCCTGGCTACTCGAGTAGCCAGGATATCTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-2065s1c1
Sequence:CCGGGAATGGCAGTTTCAAGAAGAACTCGAGTTCTTCTTGAAACTGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015318.2-397s1c1
Sequence:CCGGCGGACCAATCACAGGAGAGATCTCGAGATCTCTCCTGTGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133962
VALIDATED
ARHGEF18 MISSION shRNA Bacterial Glycerol Stock
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000110151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-2551s1c1
Sequence:CCGGGCGCAGGTTCAAGAAACAGAACTCGAGTTCTGTTTCTTGAACCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-3192s1c1
Sequence:CCGGCCACCACAGATGAAGTTAGTACTCGAGTACTAACTTCATCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-613s1c1
Sequence:CCGGCGCTGATGACTTACTGGACATCTCGAGATGTCCAGTAAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-1414s1c1
Sequence:CCGGGCCAGAGATGTATGAGATGTACTCGAGTACATCTCATACATCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133962
VALIDATED
ARHGEF18 MISSION shRNA shRNA Plasmid DNA
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000110151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-2551s1c1
Sequence:CCGGGCGCAGGTTCAAGAAACAGAACTCGAGTTCTGTTTCTTGAACCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-3192s1c1
Sequence:CCGGCCACCACAGATGAAGTTAGTACTCGAGTACTAACTTCATCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-613s1c1
Sequence:CCGGCGCTGATGACTTACTGGACATCTCGAGATGTCCAGTAAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-1414s1c1
Sequence:CCGGGCCAGAGATGTATGAGATGTACTCGAGTACATCTCATACATCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133962
VALIDATED
ARHGEF18 MISSION shRNA Lentiviral Transduction Particles
Rho/Rac guanine nucleotide exchange factor (GEF) 18
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000110151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-2551s1c1
Sequence:CCGGGCGCAGGTTCAAGAAACAGAACTCGAGTTCTGTTTCTTGAACCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-3192s1c1
Sequence:CCGGCCACCACAGATGAAGTTAGTACTCGAGTACTAACTTCATCTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-613s1c1
Sequence:CCGGCGCTGATGACTTACTGGACATCTCGAGATGTCCAGTAAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133962.3-1414s1c1
Sequence:CCGGGCCAGAGATGTATGAGATGTACTCGAGTACATCTCATACATCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks