EMAIL THIS PAGE TO A FRIEND

ARHGEF19

Rho guanine nucleotide exchange factor (GEF) 19

46 Gene Product Result for
Synonyms: WGEF
UniProtKB ID: Q8IW93, A6NJ04, Q5TEV2, Q6PJQ4, Q8N244
Gene ID:
Human(128272) Summary: Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Mouse(213649) Rho guanine nucleotide exchange factor (GEF) 19
Rat(362648) Rho guanine nucleotide exchange factor (GEF) 19
Zebrafish(569202) Rho guanine nucleotide exchange factor (GEF) 19
chicken(419033) Rho guanine nucleotide exchange factor (GEF) 19
dog(487420) Rho guanine nucleotide exchange factor (GEF) 19
Horse(100053592) Rho guanine nucleotide exchange factor (GEF) 19
cow(617280) Rho guanine nucleotide exchange factor (GEF) 19
domestic cat(101085734) Rho guanine nucleotide exchange factor (GEF) 19
sheep(101110311) Rho guanine nucleotide exchange factor (GEF) 19
naked mole-rat(101715458) Rho guanine nucleotide exchange factor (GEF) 19
domestic guinea pig(100736122) Rho guanine nucleotide exchange factor (GEF) 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153213 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153213 Rosetta Predictions human pricing
NM_001108692 Rosetta Predictions rat pricing
NM_172520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367073 predicted 2491
2 SASI_Hs01_00174916 predicted 2502
3 SASI_Hs01_00174917 predicted 735
4 SASI_Hs01_00174918 predicted 1860
5 SASI_Hs01_00174919 predicted 1526
6 SASI_Hs01_00174920 predicted 842
7 SASI_Hs01_00174921 predicted 1661
8 SASI_Hs01_00174922 predicted 2795
9 SASI_Hs01_00174923 predicted 2483
10 SASI_Hs01_00174924 predicted 2498
11 SASI_Hs01_00174925 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241135 predicted 2490
2 SASI_Rn02_00241136 predicted 2271
3 SASI_Rn02_00241137 predicted 396
4 SASI_Rn02_00241138 predicted 2479
5 SASI_Rn02_00241139 predicted 2418
6 SASI_Rn02_00241140 predicted 1159
7 SASI_Rn02_00241141 predicted 973
8 SASI_Rn02_00241142 predicted 779
9 SASI_Rn02_00241143 predicted 1984
10 SASI_Rn02_00241144 predicted 2908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059936 predicted 1691
2 SASI_Mm01_00059937 predicted 1449
3 SASI_Mm01_00059938 predicted 2969
4 SASI_Mm01_00059939 predicted 2005
5 SASI_Mm01_00059940 predicted 825
6 SASI_Mm01_00059941 predicted 2386
7 SASI_Mm01_00059942 predicted 993
8 SASI_Mm01_00059943 predicted 2045
9 SASI_Mm01_00059944 predicted 894
10 SASI_Mm01_00059945 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172520
ARHGEF19 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172520.1-3174s1c1
Sequence:CCGGGCCTCTGTGAACTTTGTGGTTCTCGAGAACCACAAAGTTCACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-899s1c1
Sequence:CCGGAGCTGATGACTAGGCTGCATTCTCGAGAATGCAGCCTAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2375s1c1
Sequence:CCGGGTGAGAAGCAACGGTGGATTTCTCGAGAAATCCACCGTTGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2164s1c1
Sequence:CCGGGTGTACCTTCACCTCTTCAATCTCGAGATTGAAGAGGTGAAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2006s1c1
Sequence:CCGGCGGAGGAACTAATTCACCTAACTCGAGTTAGGTGAATTAGTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172520
ARHGEF19 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172520.1-3174s1c1
Sequence:CCGGGCCTCTGTGAACTTTGTGGTTCTCGAGAACCACAAAGTTCACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-899s1c1
Sequence:CCGGAGCTGATGACTAGGCTGCATTCTCGAGAATGCAGCCTAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2375s1c1
Sequence:CCGGGTGAGAAGCAACGGTGGATTTCTCGAGAAATCCACCGTTGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2164s1c1
Sequence:CCGGGTGTACCTTCACCTCTTCAATCTCGAGATTGAAGAGGTGAAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2006s1c1
Sequence:CCGGCGGAGGAACTAATTCACCTAACTCGAGTTAGGTGAATTAGTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172520
ARHGEF19 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172520.1-3174s1c1
Sequence:CCGGGCCTCTGTGAACTTTGTGGTTCTCGAGAACCACAAAGTTCACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-899s1c1
Sequence:CCGGAGCTGATGACTAGGCTGCATTCTCGAGAATGCAGCCTAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2375s1c1
Sequence:CCGGGTGAGAAGCAACGGTGGATTTCTCGAGAAATCCACCGTTGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2164s1c1
Sequence:CCGGGTGTACCTTCACCTCTTCAATCTCGAGATTGAAGAGGTGAAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172520.1-2006s1c1
Sequence:CCGGCGGAGGAACTAATTCACCTAACTCGAGTTAGGTGAATTAGTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153213
ARHGEF19 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 19
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1700s1c1
Sequence:CCGGCCTCAAGATGTTGGTGGAGAACTCGAGTTCTCCACCAACATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1854s1c1
Sequence:CCGGCTGAGCAAGAAGATCCACTTTCTCGAGAAAGTGGATCTTCTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-2297s1c1
Sequence:CCGGTCAGTGTGTTAGGACATACAACTCGAGTTGTATGTCCTAACACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-989s1c1
Sequence:CCGGCCAGTCTCGATTCCTCCTTAACTCGAGTTAAGGAGGAATCGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-268s1c1
Sequence:CCGGGCCCAGTGTGTCTGGACCTTTCTCGAGAAAGGTCCAGACACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153213.3-2481s21c1
Sequence:CCGGCGAAACCTCCGGGAGAATAAGCTCGAGCTTATTCTCCCGGAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153213
ARHGEF19 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 19
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1700s1c1
Sequence:CCGGCCTCAAGATGTTGGTGGAGAACTCGAGTTCTCCACCAACATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1854s1c1
Sequence:CCGGCTGAGCAAGAAGATCCACTTTCTCGAGAAAGTGGATCTTCTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-2297s1c1
Sequence:CCGGTCAGTGTGTTAGGACATACAACTCGAGTTGTATGTCCTAACACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-989s1c1
Sequence:CCGGCCAGTCTCGATTCCTCCTTAACTCGAGTTAAGGAGGAATCGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-268s1c1
Sequence:CCGGGCCCAGTGTGTCTGGACCTTTCTCGAGAAAGGTCCAGACACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153213.3-2481s21c1
Sequence:CCGGCGAAACCTCCGGGAGAATAAGCTCGAGCTTATTCTCCCGGAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153213
ARHGEF19 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 19
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1700s1c1
Sequence:CCGGCCTCAAGATGTTGGTGGAGAACTCGAGTTCTCCACCAACATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-1854s1c1
Sequence:CCGGCTGAGCAAGAAGATCCACTTTCTCGAGAAAGTGGATCTTCTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-2297s1c1
Sequence:CCGGTCAGTGTGTTAGGACATACAACTCGAGTTGTATGTCCTAACACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-989s1c1
Sequence:CCGGCCAGTCTCGATTCCTCCTTAACTCGAGTTAAGGAGGAATCGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153213.2-268s1c1
Sequence:CCGGGCCCAGTGTGTCTGGACCTTTCTCGAGAAAGGTCCAGACACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153213.3-2481s21c1
Sequence:CCGGCGAAACCTCCGGGAGAATAAGCTCGAGCTTATTCTCCCGGAGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks