EMAIL THIS PAGE TO A FRIEND

ARHGEF1

Rho guanine nucleotide exchange factor (GEF) 1

134 Gene Product Result for
Synonyms: GEF1 LBCL2 LSC P115-RHOGEF SUB1.5
UniProtKB ID: Q92888, O00513, Q8N4J4, Q96BF4, Q96F17, Q9BSB1
Gene ID:
Human(9138) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(16801) Rho guanine nucleotide exchange factor (GEF) 1
Rat(60323) Rho guanine nucleotide exchange factor (GEF) 1
domestic cat(101083892) Rho guanine nucleotide exchange factor (GEF) 1
Horse(100069807) Rho guanine nucleotide exchange factor (GEF) 1
cow(513377) Rho guanine nucleotide exchange factor (GEF) 1
dog(484482) Rho guanine nucleotide exchange factor (GEF) 1
domestic guinea pig(100713259) Rho guanine nucleotide exchange factor (GEF) 1
naked mole-rat(101721865) Rho guanine nucleotide exchange factor (GEF) 1
sheep(101104265) Rho guanine nucleotide exchange factor (GEF) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004706 Rosetta Predictions human pricing
NM_198977 Rosetta Predictions human pricing
NM_199002 Rosetta Predictions human pricing
NM_021694 Rosetta Predictions rat pricing
XM_579447 Rosetta Predictions rat pricing
NM_001130150 Rosetta Predictions mouse pricing
NM_001130151 Rosetta Predictions mouse pricing
NM_001130152 Rosetta Predictions mouse pricing
NM_001130153 Rosetta Predictions mouse pricing
NM_008488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015149 predicted 824
2 SASI_Hs01_00015150 predicted 2377
3 SASI_Hs01_00015151 predicted 1555
4 SASI_Hs01_00015152 predicted 1071
5 SASI_Hs01_00015153 predicted 794
6 SASI_Hs01_00015154 predicted 1514
7 SASI_Hs01_00015156 predicted 1349
8 SASI_Hs01_00015157 predicted 712
9 SASI_Hs01_00015158 predicted 1708
10 SASI_Hs02_00338159 predicted 2472
11 SASI_Hs01_00015155 predicted 1841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372490 predicted 727
2 SASI_Hs01_00184362 predicted 2271
3 SASI_Hs02_00372491 predicted 1462
4 SASI_Hs01_00184364 predicted 970
5 SASI_Hs01_00184365 predicted 703
6 SASI_Hs01_00184366 predicted 2254
7 SASI_Hs01_00184367 predicted 1415
8 SASI_Hs02_00372492 predicted 1250
9 SASI_Hs02_00372493 predicted 615
10 SASI_Hs02_00372494 predicted 1611
11 SASI_Hs01_00184363 predicted 1459
12 SASI_Hs01_00184368 predicted 2279
13 SASI_Hs01_00184369 predicted 628
14 SASI_Hs01_00184370 predicted 1742
15 SASI_Hs01_00184371 predicted 2513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076049 predicted 854
2 SASI_Hs01_00076050 predicted 2399
3 SASI_Hs01_00076051 predicted 1578
4 SASI_Hs02_00372518 predicted 1096
5 SASI_Hs01_00076052 predicted 821
6 SASI_Hs01_00076053 predicted 2379
7 SASI_Hs01_00076054 predicted 1540
8 SASI_Hs01_00076056 predicted 1367
9 SASI_Hs01_00076057 predicted 737
10 SASI_Hs01_00076058 predicted 1731
11 SASI_Hs01_00076055 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096444 predicted 2087
2 SASI_Rn01_00096445 predicted 1203
3 SASI_Rn01_00096446 predicted 2742
4 SASI_Rn01_00096447 predicted 1550
5 SASI_Rn01_00096448 predicted 1399
6 SASI_Rn01_00096449 predicted 2019
7 SASI_Rn01_00096450 predicted 2589
8 SASI_Rn02_00262730 predicted 2953
9 SASI_Rn01_00096451 predicted 2332
10 SASI_Rn02_00262731 predicted 2018
11 SASI_Rn01_00096443 predicted 818
12 SASI_Rn01_00096452 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129010 predicted 720
2 SASI_Rn01_00129011 predicted 2008
3 SASI_Rn01_00129012 predicted 1121
4 SASI_Rn01_00129013 predicted 2663
5 SASI_Rn01_00129014 predicted 1468
6 SASI_Rn01_00129015 predicted 1311
7 SASI_Rn01_00129016 predicted 1939
8 SASI_Rn01_00129017 predicted 2496
9 SASI_Rn01_00129018 predicted 2245
10 SASI_Rn01_00129019 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310858 predicted 2072
2 SASI_Mm02_00310859 predicted 2495
3 SASI_Mm02_00310860 predicted 1780
4 SASI_Mm02_00310861 predicted 2580
5 SASI_Mm02_00310862 predicted 424
6 SASI_Mm02_00310863 predicted 3190
7 SASI_Mm02_00310864 predicted 690
8 SASI_Mm02_00310865 predicted 2961
9 SASI_Mm02_00310866 predicted 2318
10 SASI_Mm02_00310867 predicted 2230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310868 predicted 2066
2 SASI_Mm02_00310869 predicted 2484
3 SASI_Mm02_00310870 predicted 1764
4 SASI_Mm02_00310871 predicted 2573
5 SASI_Mm02_00310872 predicted 425
6 SASI_Mm02_00310873 predicted 3178
7 SASI_Mm02_00310874 predicted 687
8 SASI_Mm02_00310875 predicted 2948
9 SASI_Mm02_00310876 predicted 2309
10 SASI_Mm02_00310877 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310878 predicted 1901
2 SASI_Mm02_00310879 predicted 2328
3 SASI_Mm02_00310880 predicted 1604
4 SASI_Mm02_00310881 predicted 2418
5 SASI_Mm02_00310882 predicted 438
6 SASI_Mm02_00310883 predicted 3021
7 SASI_Mm02_00310884 predicted 703
8 SASI_Mm02_00310885 predicted 2794
9 SASI_Mm02_00310886 predicted 2154
10 SASI_Mm02_00310887 predicted 2057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310888 predicted 1891
2 SASI_Mm02_00310889 predicted 2317
3 SASI_Mm02_00310890 predicted 1600
4 SASI_Mm02_00310891 predicted 2405
5 SASI_Mm02_00310892 predicted 426
6 SASI_Mm02_00310893 predicted 3010
7 SASI_Mm02_00310894 predicted 690
8 SASI_Mm02_00310895 predicted 2777
9 SASI_Mm02_00310896 predicted 2137
10 SASI_Mm02_00310897 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118593 predicted 1891
2 SASI_Mm01_00118594 predicted 2311
3 SASI_Mm02_00314016 predicted 1601
4 SASI_Mm01_00118595 predicted 2402
5 SASI_Mm01_00118597 predicted 423
6 SASI_Mm01_00118598 predicted 3007
7 SASI_Mm01_00118600 predicted 694
8 SASI_Mm02_00314017 predicted 2773
9 SASI_Mm01_00118601 predicted 2141
10 SASI_Mm02_00314018 predicted 2047
11 SASI_Mm01_00118592 predicted 799
12 SASI_Mm01_00118596 predicted 1385
13 SASI_Mm01_00118599 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004706
VALIDATED
ARHGEF1 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-337s21c1
Sequence:CCGGTTGCTGTCTGCATGCCGACATCTCGAGATGTCGGCATGCAGACAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1897s21c1
Sequence:CCGGGGAAATTCTACACCACGTCAACTCGAGTTGACGTGGTGTAGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-2004s21c1
Sequence:CCGGACCCTATGCTGAGCGAGTTCACTCGAGTGAACTCGCTCAGCATAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1527s21c1
Sequence:CCGGTGTTCCTCGATCGCCTGATGACTCGAGTCATCAGGCGATCGAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-465s1c1
Sequence:CCGGCCTTTGAACTTGACCGCACTACTCGAGTAGTGCGGTCAAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2266s1c1
Sequence:CCGGCACCGATCACAAAGCCTTCTACTCGAGTAGAAGGCTTTGTGATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2606s1c1
Sequence:CCGGTCCCTGAAGCAGCTTCTGTTTCTCGAGAAACAGAAGCTGCTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-729s1c1
Sequence:CCGGCCATCTCTACCGACGAAGAAACTCGAGTTTCTTCGTCGGTAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004706.3-1444s1c1
Sequence:CCGGCATGGCAGAATGCCTGTTCTTCTCGAGAAGAACAGGCATTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004706
VALIDATED
ARHGEF1 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-337s21c1
Sequence:CCGGTTGCTGTCTGCATGCCGACATCTCGAGATGTCGGCATGCAGACAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1897s21c1
Sequence:CCGGGGAAATTCTACACCACGTCAACTCGAGTTGACGTGGTGTAGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-2004s21c1
Sequence:CCGGACCCTATGCTGAGCGAGTTCACTCGAGTGAACTCGCTCAGCATAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1527s21c1
Sequence:CCGGTGTTCCTCGATCGCCTGATGACTCGAGTCATCAGGCGATCGAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-465s1c1
Sequence:CCGGCCTTTGAACTTGACCGCACTACTCGAGTAGTGCGGTCAAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2266s1c1
Sequence:CCGGCACCGATCACAAAGCCTTCTACTCGAGTAGAAGGCTTTGTGATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2606s1c1
Sequence:CCGGTCCCTGAAGCAGCTTCTGTTTCTCGAGAAACAGAAGCTGCTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-729s1c1
Sequence:CCGGCCATCTCTACCGACGAAGAAACTCGAGTTTCTTCGTCGGTAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004706.3-1444s1c1
Sequence:CCGGCATGGCAGAATGCCTGTTCTTCTCGAGAAGAACAGGCATTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004706
VALIDATED
ARHGEF1 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-337s21c1
Sequence:CCGGTTGCTGTCTGCATGCCGACATCTCGAGATGTCGGCATGCAGACAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1897s21c1
Sequence:CCGGGGAAATTCTACACCACGTCAACTCGAGTTGACGTGGTGTAGAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-2004s21c1
Sequence:CCGGACCCTATGCTGAGCGAGTTCACTCGAGTGAACTCGCTCAGCATAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004706.3-1527s21c1
Sequence:CCGGTGTTCCTCGATCGCCTGATGACTCGAGTCATCAGGCGATCGAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-465s1c1
Sequence:CCGGCCTTTGAACTTGACCGCACTACTCGAGTAGTGCGGTCAAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2266s1c1
Sequence:CCGGCACCGATCACAAAGCCTTCTACTCGAGTAGAAGGCTTTGTGATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-2606s1c1
Sequence:CCGGTCCCTGAAGCAGCTTCTGTTTCTCGAGAAACAGAAGCTGCTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004706.3-729s1c1
Sequence:CCGGCCATCTCTACCGACGAAGAAACTCGAGTTTCTTCGTCGGTAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004706.3-1444s1c1
Sequence:CCGGCATGGCAGAATGCCTGTTCTTCTCGAGAAGAACAGGCATTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008488
ARHGEF1 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-464s1c1
Sequence:CCGGCCTGATCTGATCTCTGAGGATCTCGAGATCCTCAGAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008488.1-2937s1c1
Sequence:CCGGAGAGGGAGATTGGCTGAACTTCTCGAGAAGTTCAGCCAATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-373s1c1
Sequence:CCGGCCTTGACTTCTATCACAGTTTCTCGAGAAACTGTGATAGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-2057s1c1
Sequence:CCGGGTGACCAAAGACAAAGCTATACTCGAGTATAGCTTTGTCTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-1738s1c1
Sequence:CCGGCCTACAGTTAAAGGACATGATCTCGAGATCATGTCCTTTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008488
ARHGEF1 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-464s1c1
Sequence:CCGGCCTGATCTGATCTCTGAGGATCTCGAGATCCTCAGAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008488.1-2937s1c1
Sequence:CCGGAGAGGGAGATTGGCTGAACTTCTCGAGAAGTTCAGCCAATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-373s1c1
Sequence:CCGGCCTTGACTTCTATCACAGTTTCTCGAGAAACTGTGATAGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-2057s1c1
Sequence:CCGGGTGACCAAAGACAAAGCTATACTCGAGTATAGCTTTGTCTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-1738s1c1
Sequence:CCGGCCTACAGTTAAAGGACATGATCTCGAGATCATGTCCTTTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008488
ARHGEF1 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-464s1c1
Sequence:CCGGCCTGATCTGATCTCTGAGGATCTCGAGATCCTCAGAGATCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008488.1-2937s1c1
Sequence:CCGGAGAGGGAGATTGGCTGAACTTCTCGAGAAGTTCAGCCAATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-373s1c1
Sequence:CCGGCCTTGACTTCTATCACAGTTTCTCGAGAAACTGTGATAGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-2057s1c1
Sequence:CCGGGTGACCAAAGACAAAGCTATACTCGAGTATAGCTTTGTCTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008488.1-1738s1c1
Sequence:CCGGCCTACAGTTAAAGGACATGATCTCGAGATCATGTCCTTTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks