EMAIL THIS PAGE TO A FRIEND

ARHGEF25

Rho guanine nucleotide exchange factor (GEF) 25

111 Gene Product Result for
Synonyms: GEFT p63RhoGEF
UniProtKB ID: Q86VW2, A6NJH5, A9CQZ6, F8W7Z4, Q8WV84, Q96E63
Gene ID:
Human(115557) Summary: Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(52666) Rho guanine nucleotide exchange factor (GEF) 25
Rat(314904) Rho guanine nucleotide exchange factor (GEF) 25
sheep(101118430) Rho guanine nucleotide exchange factor (GEF) 25
Domestic Rabbit(100339852) Rho guanine nucleotide exchange factor (GEF) 25
naked mole-rat(101710520) Rho guanine nucleotide exchange factor (GEF) 25
domestic guinea pig(100719628) Rho guanine nucleotide exchange factor (GEF) 25
dog(607485) Rho guanine nucleotide exchange factor (GEF) 25
domestic cat(101095589) Rho guanine nucleotide exchange factor (GEF) 25
cow(506075) Rho guanine nucleotide exchange factor (GEF) 25
Horse(100050699) Rho guanine nucleotide exchange factor (GEF) 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001111270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001111270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001111270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111270 Rosetta Predictions human pricing
NM_133483 Rosetta Predictions human pricing
NM_182947 Rosetta Predictions human pricing
NM_199395 Rosetta Predictions rat pricing
NM_028027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325294 predicted 691
2 SASI_Hs02_00325295 predicted 823
3 SASI_Hs02_00325296 predicted 1084
4 SASI_Hs02_00325297 predicted 805
5 SASI_Hs02_00325298 predicted 777
6 SASI_Hs02_00325299 predicted 767
7 SASI_Hs02_00325300 predicted 693
8 SASI_Hs02_00325301 predicted 458
9 SASI_Hs02_00325302 predicted 885
10 SASI_Hs02_00325303 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047848 predicted 1687
2 SASI_Hs01_00047849 predicted 1619
3 SASI_Hs01_00047850 predicted 511
4 SASI_Hs01_00047851 predicted 1628
5 SASI_Hs01_00047852 predicted 1432
6 SASI_Hs01_00047853 predicted 1721
7 SASI_Hs01_00047854 predicted 1416
8 SASI_Hs01_00047855 predicted 1581
9 SASI_Hs01_00047856 predicted 1725
10 SASI_Hs01_00047857 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371083 predicted 997
2 SASI_Hs02_00371084 predicted 1123
3 SASI_Hs02_00371085 predicted 1397
4 SASI_Hs02_00371086 predicted 1107
5 SASI_Hs02_00371087 predicted 1082
6 SASI_Hs02_00371088 predicted 1075
7 SASI_Hs02_00371089 predicted 998
8 SASI_Hs02_00371090 predicted 758
9 SASI_Hs02_00371091 predicted 1190
10 SASI_Hs02_00371092 predicted 755
11 SASI_Hs01_00049954 predicted 2133
12 SASI_Hs01_00049955 predicted 2069
13 SASI_Hs01_00049956 predicted 956
14 SASI_Hs01_00049957 predicted 2075
15 SASI_Hs01_00049958 predicted 1874
16 SASI_Hs01_00049959 predicted 2169
17 SASI_Hs01_00049960 predicted 1864
18 SASI_Hs01_00049961 predicted 2032
19 SASI_Hs01_00049962 predicted 2172
20 SASI_Hs01_00049963 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270219 predicted 1737
2 SASI_Rn01_00113881 predicted 430
3 SASI_Rn01_00113882 predicted 655
4 SASI_Rn01_00113883 predicted 911
5 SASI_Rn01_00113884 predicted 491
6 SASI_Rn01_00113886 predicted 871
7 SASI_Rn01_00113887 predicted 1538
8 SASI_Rn01_00113888 predicted 671
9 SASI_Rn01_00113890 predicted 773
10 SASI_Rn02_00270220 predicted 379
11 SASI_Rn01_00113885 predicted 748
12 SASI_Rn01_00113889 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084765 predicted 1923
2 SASI_Mm02_00333170 predicted 1889
3 SASI_Mm01_00084766 predicted 1975
4 SASI_Mm01_00084767 predicted 519
5 SASI_Mm01_00084768 predicted 1931
6 SASI_Mm01_00084770 predicted 706
7 SASI_Mm01_00084771 predicted 1013
8 SASI_Mm01_00084772 predicted 514
9 SASI_Mm01_00084773 predicted 793
10 SASI_Mm02_00333171 predicted 898
11 SASI_Mm01_00084769 predicted 1586
12 SASI_Mm01_00084774 predicted 1330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133483
VALIDATED
ARHGEF25 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-691s1c1
Sequence:CCGGCGGTGTCTGAAAGATCCTGATCTCGAGATCAGGATCTTTCAGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-481s1c1
Sequence:CCGGGCTCTGGAAAGGAGTATGTATCTCGAGATACATACTCCTTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1723s1c1
Sequence:CCGGAGACTTGCCAAGCTGGATGAACTCGAGTTCATCCAGCTTGGCAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-630s1c1
Sequence:CCGGGTTTGGGAATATCCAGCAAATCTCGAGATTTGCTGGATATTCCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1221s1c1
Sequence:CCGGGCCTGGATATGTATACAAGAACTCGAGTTCTTGTATACATATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133483
VALIDATED
ARHGEF25 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-691s1c1
Sequence:CCGGCGGTGTCTGAAAGATCCTGATCTCGAGATCAGGATCTTTCAGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-481s1c1
Sequence:CCGGGCTCTGGAAAGGAGTATGTATCTCGAGATACATACTCCTTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1723s1c1
Sequence:CCGGAGACTTGCCAAGCTGGATGAACTCGAGTTCATCCAGCTTGGCAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-630s1c1
Sequence:CCGGGTTTGGGAATATCCAGCAAATCTCGAGATTTGCTGGATATTCCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1221s1c1
Sequence:CCGGGCCTGGATATGTATACAAGAACTCGAGTTCTTGTATACATATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133483
VALIDATED
ARHGEF25 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-691s1c1
Sequence:CCGGCGGTGTCTGAAAGATCCTGATCTCGAGATCAGGATCTTTCAGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133483.1-481s1c1
Sequence:CCGGGCTCTGGAAAGGAGTATGTATCTCGAGATACATACTCCTTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1723s1c1
Sequence:CCGGAGACTTGCCAAGCTGGATGAACTCGAGTTCATCCAGCTTGGCAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-630s1c1
Sequence:CCGGGTTTGGGAATATCCAGCAAATCTCGAGATTTGCTGGATATTCCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133483.1-1221s1c1
Sequence:CCGGGCCTGGATATGTATACAAGAACTCGAGTTCTTGTATACATATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028027
VALIDATED
ARHGEF25 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028027.1-1941s1c1
Sequence:CCGGGCATGATTCCTCAATGAATTTCTCGAGAAATTCATTGAGGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-1577s1c1
Sequence:CCGGCGTGACTTTCTCAACGCATTACTCGAGTAATGCGTTGAGAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-852s1c1
Sequence:CCGGAGTGTTTGAAAGATCCCGATTCTCGAGAATCGGGATCTTTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028027.1-1592s1c1
Sequence:CCGGGCATTACAGTCACCCATTGAACTCGAGTTCAATGGGTGACTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-500s1c1
Sequence:CCGGCCAACTTTAACCACAGGACAACTCGAGTTGTCCTGTGGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028027
VALIDATED
ARHGEF25 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028027.1-1941s1c1
Sequence:CCGGGCATGATTCCTCAATGAATTTCTCGAGAAATTCATTGAGGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-1577s1c1
Sequence:CCGGCGTGACTTTCTCAACGCATTACTCGAGTAATGCGTTGAGAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-852s1c1
Sequence:CCGGAGTGTTTGAAAGATCCCGATTCTCGAGAATCGGGATCTTTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028027.1-1592s1c1
Sequence:CCGGGCATTACAGTCACCCATTGAACTCGAGTTCAATGGGTGACTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-500s1c1
Sequence:CCGGCCAACTTTAACCACAGGACAACTCGAGTTGTCCTGTGGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028027
VALIDATED
ARHGEF25 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028027.1-1941s1c1
Sequence:CCGGGCATGATTCCTCAATGAATTTCTCGAGAAATTCATTGAGGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-1577s1c1
Sequence:CCGGCGTGACTTTCTCAACGCATTACTCGAGTAATGCGTTGAGAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-852s1c1
Sequence:CCGGAGTGTTTGAAAGATCCCGATTCTCGAGAATCGGGATCTTTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028027.1-1592s1c1
Sequence:CCGGGCATTACAGTCACCCATTGAACTCGAGTTCAATGGGTGACTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028027.1-500s1c1
Sequence:CCGGCCAACTTTAACCACAGGACAACTCGAGTTGTCCTGTGGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111270
VALIDATED
ARHGEF25 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111270.1-240s21c1
Sequence:CCGGCTCTGCAGCCCGAATCCTATTCTCGAGAATAGGATTCGGGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-795s21c1
Sequence:CCGGATGAGTGGCACCGAGACTATTCTCGAGAATAGTCTCGGTGCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-694s21c1
Sequence:CCGGGCAGATTGTGGAGGGTTATATCTCGAGATATAACCCTCCACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111270.1-2014s21c1
Sequence:CCGGCAAGGCTGGGAGGGATATCAACTCGAGTTGATATCCCTCCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-764s21c1
Sequence:GTACCGGAGGATTGTGTTTGGGAATATCCTCGAGGATATTCCCAAACACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111270
VALIDATED
ARHGEF25 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111270.1-240s21c1
Sequence:CCGGCTCTGCAGCCCGAATCCTATTCTCGAGAATAGGATTCGGGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-795s21c1
Sequence:CCGGATGAGTGGCACCGAGACTATTCTCGAGAATAGTCTCGGTGCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-694s21c1
Sequence:CCGGGCAGATTGTGGAGGGTTATATCTCGAGATATAACCCTCCACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111270.1-2014s21c1
Sequence:CCGGCAAGGCTGGGAGGGATATCAACTCGAGTTGATATCCCTCCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-764s21c1
Sequence:GTACCGGAGGATTGTGTTTGGGAATATCCTCGAGGATATTCCCAAACACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111270
VALIDATED
ARHGEF25 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111270.1-240s21c1
Sequence:CCGGCTCTGCAGCCCGAATCCTATTCTCGAGAATAGGATTCGGGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-795s21c1
Sequence:CCGGATGAGTGGCACCGAGACTATTCTCGAGAATAGTCTCGGTGCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-694s21c1
Sequence:CCGGGCAGATTGTGGAGGGTTATATCTCGAGATATAACCCTCCACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111270.1-2014s21c1
Sequence:CCGGCAAGGCTGGGAGGGATATCAACTCGAGTTGATATCCCTCCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001111270.1-764s21c1
Sequence:GTACCGGAGGATTGTGTTTGGGAATATCCTCGAGGATATTCCCAAACACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks