EMAIL THIS PAGE TO A FRIEND

ARHGEF26

Rho guanine nucleotide exchange factor (GEF) 26

177 Gene Product Result for
Synonyms: CSGEF HMFN1864 SGEF
Gene ID:
Human(26084) Summary: This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(622434) Rho guanine nucleotide exchange factor (GEF) 26
Rat(310460) Rho guanine nucleotide exchange factor (GEF) 26
chicken(429163) Rho guanine nucleotide exchange factor (GEF) 26
cow(531741) Rho guanine nucleotide exchange factor (GEF) 26
domestic cat(101090134) Rho guanine nucleotide exchange factor (GEF) 26
dog(611857) Rho guanine nucleotide exchange factor (GEF) 26
domestic guinea pig(100725058) Rho guanine nucleotide exchange factor (GEF) 26
naked mole-rat(101713494) Rho guanine nucleotide exchange factor (GEF) 26
sheep(101113898) Rho guanine nucleotide exchange factor (GEF) 26
Domestic Rabbit(100355060) Rho guanine nucleotide exchange factor (GEF) 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015595 Rosetta Predictions human pricing
XM_001063458 Rosetta Predictions rat pricing
XM_227201 Rosetta Predictions rat pricing
NM_001081295 Rosetta Predictions mouse pricing
XM_887737 Rosetta Predictions mouse pricing
XM_897631 Rosetta Predictions mouse pricing
XM_897660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348174 predicted 2546
2 SASI_Hs01_00110430 predicted 1950
3 SASI_Hs01_00110431 predicted 1771
4 SASI_Hs02_00348175 predicted 2288
5 SASI_Hs02_00348176 predicted 1676
6 SASI_Hs01_00110433 predicted 2292
7 SASI_Hs01_00110434 predicted 1578
8 SASI_Hs01_00110435 predicted 2016
9 SASI_Hs01_00110436 predicted 1807
10 SASI_Hs01_00110439 predicted 2706
11 SASI_Hs01_00110432 predicted 1398
12 SASI_Hs01_00110437 predicted 2256
13 SASI_Hs01_00110438 predicted 2839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307206 predicted 2304
2 SASI_Rn02_00307207 predicted 1796
3 SASI_Rn02_00307208 predicted 1184
4 SASI_Rn02_00307209 predicted 2822
5 SASI_Rn02_00307210 predicted 1546
6 SASI_Rn02_00307211 predicted 1502
7 SASI_Rn02_00307212 predicted 2216
8 SASI_Rn02_00307213 predicted 1765
9 SASI_Rn02_00307214 predicted 2520
10 SASI_Rn02_00307215 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384166 predicted 2448
2 SASI_Rn02_00384167 predicted 2784
3 SASI_Rn02_00384168 predicted 426
4 SASI_Rn02_00384169 predicted 2824
5 SASI_Rn02_00384170 predicted 2466
6 SASI_Rn02_00384171 predicted 2520
7 SASI_Rn02_00384172 predicted 2715
8 SASI_Rn02_00384173 predicted 2772
9 SASI_Rn02_00384174 predicted 2560
10 SASI_Rn02_00384175 predicted 2577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297071 predicted 3115
2 SASI_Mm02_00297072 predicted 2860
3 SASI_Mm02_00297073 predicted 3366
4 SASI_Mm02_00297074 predicted 3344
5 SASI_Mm02_00297075 predicted 1331
6 SASI_Mm02_00297076 predicted 1501
7 SASI_Mm02_00297077 predicted 2291
8 SASI_Mm02_00297078 predicted 1924
9 SASI_Mm02_00297079 predicted 3406
10 SASI_Mm02_00297080 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270308 predicted 3121
2 SASI_Mm01_00270309 predicted 2863
3 SASI_Mm01_00270310 predicted 3364
4 SASI_Mm01_00270311 predicted 3357
5 SASI_Mm01_00270312 predicted 1253
6 SASI_Mm01_00270313 predicted 2763
7 SASI_Mm01_00270314 predicted 1502
8 SASI_Mm01_00270315 predicted 2299
9 SASI_Mm01_00270316 predicted 1933
10 SASI_Mm01_00270317 predicted 3415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230416 predicted 724
2 SASI_Mm01_00230417 predicted 1231
3 SASI_Mm01_00230418 predicted 1230
4 SASI_Mm01_00230419 predicted 1488
5 SASI_Mm01_00230420 predicted 1258
6 SASI_Mm01_00230421 predicted 932
7 SASI_Mm01_00230422 predicted 1341
8 SASI_Mm01_00230423 predicted 1265
9 SASI_Mm01_00230424 predicted 1403
10 SASI_Mm01_00230425 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234589 predicted 546
2 SASI_Mm01_00234590 predicted 685
3 SASI_Mm01_00234591 predicted 297
4 SASI_Mm01_00234592 predicted 794
5 SASI_Mm01_00234593 predicted 783
6 SASI_Mm01_00234594 predicted 776
7 SASI_Mm01_00234595 predicted 839
8 SASI_Mm01_00234596 predicted 828
9 SASI_Mm01_00234597 predicted 529
10 SASI_Mm01_00234598 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015595
VALIDATED
ARHGEF26 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 26
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2050s21c1
Sequence:CCGGTAGCAAGTTGGTTCGACTATGCTCGAGCATAGTCGAACCAACTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1553s21c1
Sequence:CCGGATATCCTCTGAACATTCATATCTCGAGATATGAATGTTCAGAGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1527s21c1
Sequence:CCGGAGAGACAAGAGGCTATCTTTGCTCGAGCAAAGATAGCCTCTTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015595.3-3097s21c1
Sequence:CCGGATCTCTGCTCCTCCTAGTTTCCTCGAGGAAACTAGGAGGAGCAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-735s21c1
Sequence:CCGGCAAATGGCCTTGCCGCTAATACTCGAGTATTAGCGGCAAGGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2758s21c1
Sequence:CCGGATGTCAAGCTACAATTGATAACTCGAGTTATCAATTGTAGCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2330s21c1
Sequence:CCGGTCCTTAAGAGATCAGCTATTGCTCGAGCAATAGCTGATCTCTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015595.2-1733s1c1
Sequence:CCGGGCATCCACATTTGACCCATATCTCGAGATATGGGTCAAATGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-298s1c1
Sequence:CCGGCGGGTTACTAATTACGGATTTCTCGAGAAATCCGTAATTAGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-1967s1c1
Sequence:CCGGCCGAAGTATGAAGTCTGCAAACTCGAGTTTGCAGACTTCATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2203s1c1
Sequence:CCGGGCAAGTCTACTTCTTTCTCTTCTCGAGAAGAGAAAGAAGTAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2425s1c1
Sequence:CCGGCGCGAATGAGAAAGTGGAGATCTCGAGATCTCCACTTTCTCATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015595
VALIDATED
ARHGEF26 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 26
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2050s21c1
Sequence:CCGGTAGCAAGTTGGTTCGACTATGCTCGAGCATAGTCGAACCAACTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1553s21c1
Sequence:CCGGATATCCTCTGAACATTCATATCTCGAGATATGAATGTTCAGAGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1527s21c1
Sequence:CCGGAGAGACAAGAGGCTATCTTTGCTCGAGCAAAGATAGCCTCTTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015595.3-3097s21c1
Sequence:CCGGATCTCTGCTCCTCCTAGTTTCCTCGAGGAAACTAGGAGGAGCAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-735s21c1
Sequence:CCGGCAAATGGCCTTGCCGCTAATACTCGAGTATTAGCGGCAAGGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2758s21c1
Sequence:CCGGATGTCAAGCTACAATTGATAACTCGAGTTATCAATTGTAGCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2330s21c1
Sequence:CCGGTCCTTAAGAGATCAGCTATTGCTCGAGCAATAGCTGATCTCTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015595.2-1733s1c1
Sequence:CCGGGCATCCACATTTGACCCATATCTCGAGATATGGGTCAAATGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-298s1c1
Sequence:CCGGCGGGTTACTAATTACGGATTTCTCGAGAAATCCGTAATTAGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-1967s1c1
Sequence:CCGGCCGAAGTATGAAGTCTGCAAACTCGAGTTTGCAGACTTCATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2203s1c1
Sequence:CCGGGCAAGTCTACTTCTTTCTCTTCTCGAGAAGAGAAAGAAGTAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2425s1c1
Sequence:CCGGCGCGAATGAGAAAGTGGAGATCTCGAGATCTCCACTTTCTCATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015595
VALIDATED
ARHGEF26 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 26
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2050s21c1
Sequence:CCGGTAGCAAGTTGGTTCGACTATGCTCGAGCATAGTCGAACCAACTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1553s21c1
Sequence:CCGGATATCCTCTGAACATTCATATCTCGAGATATGAATGTTCAGAGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-1527s21c1
Sequence:CCGGAGAGACAAGAGGCTATCTTTGCTCGAGCAAAGATAGCCTCTTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015595.3-3097s21c1
Sequence:CCGGATCTCTGCTCCTCCTAGTTTCCTCGAGGAAACTAGGAGGAGCAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-735s21c1
Sequence:CCGGCAAATGGCCTTGCCGCTAATACTCGAGTATTAGCGGCAAGGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2758s21c1
Sequence:CCGGATGTCAAGCTACAATTGATAACTCGAGTTATCAATTGTAGCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015595.3-2330s21c1
Sequence:CCGGTCCTTAAGAGATCAGCTATTGCTCGAGCAATAGCTGATCTCTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015595.2-1733s1c1
Sequence:CCGGGCATCCACATTTGACCCATATCTCGAGATATGGGTCAAATGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-298s1c1
Sequence:CCGGCGGGTTACTAATTACGGATTTCTCGAGAAATCCGTAATTAGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-1967s1c1
Sequence:CCGGCCGAAGTATGAAGTCTGCAAACTCGAGTTTGCAGACTTCATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2203s1c1
Sequence:CCGGGCAAGTCTACTTCTTTCTCTTCTCGAGAAGAGAAAGAAGTAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015595.2-2425s1c1
Sequence:CCGGCGCGAATGAGAAAGTGGAGATCTCGAGATCTCCACTTTCTCATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081295
ARHGEF26 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 26
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2607s21c1
Sequence:CCGGGATGATGTACACGATTAATTCCTCGAGGAATTAATCGTGTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081295.1-4801s21c1
Sequence:CCGGATACCCATTTGGAGCTATAAACTCGAGTTTATAGCTCCAAATGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-1447s21c1
Sequence:CCGGATGGGAAAGCAGCAGATTATCCTCGAGGATAATCTGCTGCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2354s21c1
Sequence:CCGGTAGCAACCAACCCGTCCTTTACTCGAGTAAAGGACGGGTTGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081295
ARHGEF26 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 26
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2607s21c1
Sequence:CCGGGATGATGTACACGATTAATTCCTCGAGGAATTAATCGTGTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081295.1-4801s21c1
Sequence:CCGGATACCCATTTGGAGCTATAAACTCGAGTTTATAGCTCCAAATGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-1447s21c1
Sequence:CCGGATGGGAAAGCAGCAGATTATCCTCGAGGATAATCTGCTGCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2354s21c1
Sequence:CCGGTAGCAACCAACCCGTCCTTTACTCGAGTAAAGGACGGGTTGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081295
ARHGEF26 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 26
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2607s21c1
Sequence:CCGGGATGATGTACACGATTAATTCCTCGAGGAATTAATCGTGTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081295.1-4801s21c1
Sequence:CCGGATACCCATTTGGAGCTATAAACTCGAGTTTATAGCTCCAAATGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-1447s21c1
Sequence:CCGGATGGGAAAGCAGCAGATTATCCTCGAGGATAATCTGCTGCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081295.1-2354s21c1
Sequence:CCGGTAGCAACCAACCCGTCCTTTACTCGAGTAAAGGACGGGTTGGTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks