EMAIL THIS PAGE TO A FRIEND

ARHGEF28

Rho guanine nucleotide exchange factor (GEF) 28

94 Gene Product Result for
Synonyms: RGNEF RIP2 p190RHOGEF
Gene ID:
Human(64283) Summary: This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Mouse(110596) Rho guanine nucleotide exchange factor (GEF) 28
Rat(361882) Rho guanine nucleotide exchange factor (GEF) 28
Zebrafish(559941) Rho guanine nucleotide exchange factor (GEF) 28
domestic cat(101094325) Rho guanine nucleotide exchange factor (GEF) 28
dog(487245) Rho guanine nucleotide exchange factor (GEF) 28
sheep(101112674) Rho guanine nucleotide exchange factor (GEF) 28
naked mole-rat(101711331) Rho guanine nucleotide exchange factor (GEF) 28
domestic guinea pig(100733738) Rho guanine nucleotide exchange factor (GEF) 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037602 Anti-ARHGEF28 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080479 Rosetta Predictions human pricing
XM_371755 Rosetta Predictions human pricing
XM_932949 Rosetta Predictions human pricing
NM_001108542 Rosetta Predictions rat pricing
NM_012026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315236 predicted 2575
2 SASI_Hs02_00315237 predicted 1445
3 SASI_Hs02_00315238 predicted 1926
4 SASI_Hs02_00315239 predicted 2060
5 SASI_Hs02_00315240 predicted 3030
6 SASI_Hs02_00315241 predicted 4272
7 SASI_Hs02_00315242 predicted 755
8 SASI_Hs02_00315243 predicted 4986
9 SASI_Hs02_00315244 predicted 1664
10 SASI_Hs02_00315245 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264015 predicted 3420
2 SASI_Hs01_00264016 predicted 3831
3 SASI_Hs01_00264017 predicted 3912
4 SASI_Hs01_00264018 predicted 3835
5 SASI_Hs01_00264019 predicted 3607
6 SASI_Hs01_00264020 predicted 3843
7 SASI_Hs01_00264021 predicted 3844
8 SASI_Hs01_00264022 predicted 3667
9 SASI_Hs01_00264023 predicted 3567
10 SASI_Hs01_00264024 predicted 3559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281654 predicted 1248
2 SASI_Hs01_00281655 predicted 1676
3 SASI_Hs01_00281656 predicted 1280
4 SASI_Hs01_00281657 predicted 1164
5 SASI_Hs01_00281658 predicted 1647
6 SASI_Hs01_00281659 predicted 479
7 SASI_Hs01_00281660 predicted 590
8 SASI_Hs01_00281661 predicted 1497
9 SASI_Hs01_00281662 predicted 801
10 SASI_Hs01_00281663 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239669 predicted 1216
2 SASI_Rn02_00239670 predicted 4921
3 SASI_Rn02_00239671 predicted 1231
4 SASI_Rn02_00239672 predicted 522
5 SASI_Rn02_00239673 predicted 3576
6 SASI_Rn02_00239674 predicted 2769
7 SASI_Rn02_00239675 predicted 2535
8 SASI_Rn02_00239676 predicted 204
9 SASI_Rn02_00239677 predicted 4696
10 SASI_Rn02_00239678 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170536 predicted 1836
2 SASI_Mm01_00170537 predicted 1255
3 SASI_Mm02_00321993 predicted 3835
4 SASI_Mm01_00170538 predicted 3724
5 SASI_Mm01_00170539 predicted 4816
6 SASI_Mm02_00321994 predicted 4036
7 SASI_Mm01_00170540 predicted 1681
8 SASI_Mm01_00170541 predicted 560
9 SASI_Mm01_00170542 predicted 893
10 SASI_Mm01_00170543 predicted 254
11 SASI_Mm01_00170544 predicted 4958
12 SASI_Mm01_00170545 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371755
ARHGEF28 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1714s1c1
Sequence:CCGGCCCGAGGTAATGGAACTTAATCTCGAGATTAAGTTCCATTACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1822s1c1
Sequence:CCGGCCATCAGTTATCCATCAGGATCTCGAGATCCTGATGGATAACTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-750s1c1
Sequence:CCGGCCAACAAATTTGTGCGTATTTCTCGAGAAATACGCACAAATTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-2024s1c1
Sequence:CCGGCCAGTATGACAAAGTGCAGTTCTCGAGAACTGCACTTTGTCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-469s1c1
Sequence:CCGGCCATCAGTTATTTCCCTTCAACTCGAGTTGAAGGGAAATAACTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371755
ARHGEF28 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1714s1c1
Sequence:CCGGCCCGAGGTAATGGAACTTAATCTCGAGATTAAGTTCCATTACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1822s1c1
Sequence:CCGGCCATCAGTTATCCATCAGGATCTCGAGATCCTGATGGATAACTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-750s1c1
Sequence:CCGGCCAACAAATTTGTGCGTATTTCTCGAGAAATACGCACAAATTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-2024s1c1
Sequence:CCGGCCAGTATGACAAAGTGCAGTTCTCGAGAACTGCACTTTGTCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-469s1c1
Sequence:CCGGCCATCAGTTATTTCCCTTCAACTCGAGTTGAAGGGAAATAACTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371755
ARHGEF28 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1714s1c1
Sequence:CCGGCCCGAGGTAATGGAACTTAATCTCGAGATTAAGTTCCATTACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-1822s1c1
Sequence:CCGGCCATCAGTTATCCATCAGGATCTCGAGATCCTGATGGATAACTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-750s1c1
Sequence:CCGGCCAACAAATTTGTGCGTATTTCTCGAGAAATACGCACAAATTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-2024s1c1
Sequence:CCGGCCAGTATGACAAAGTGCAGTTCTCGAGAACTGCACTTTGTCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371755.2-469s1c1
Sequence:CCGGCCATCAGTTATTTCCCTTCAACTCGAGTTGAAGGGAAATAACTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012026
ARHGEF28 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 28
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012026.1-5202s1c1
Sequence:CCGGCCTCTGATTGTGTGGCCATTTCTCGAGAAATGGCCACACAATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-703s1c1
Sequence:CCGGCCACACCATTAGACTTAGCTTCTCGAGAAGCTAAGTCTAATGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2189s1c1
Sequence:CCGGGCCTCCGTGTACCAAGAAATTCTCGAGAATTTCTTGGTACACGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-3732s1c1
Sequence:CCGGGCCAAGATTCAGCAATGTCAACTCGAGTTGACATTGCTGAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2001s1c1
Sequence:CCGGCGGAACAAATCTAAGATGAAACTCGAGTTTCATCTTAGATTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012026.2-5336s21c1
Sequence:CCGGATATCCCATGCACGTTCAATTCTCGAGAATTGAACGTGCATGGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-1255s21c1
Sequence:CCGGGCGATTTGGATATCAACTATACTCGAGTATAGTTGATATCCAAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-896s21c1
Sequence:CCGGCATCAAACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-3178s21c1
Sequence:CCGGGCAAAGCTCTCGGCTTAATTACTCGAGTAATTAAGCCGAGAGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012026
ARHGEF28 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 28
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012026.1-5202s1c1
Sequence:CCGGCCTCTGATTGTGTGGCCATTTCTCGAGAAATGGCCACACAATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-703s1c1
Sequence:CCGGCCACACCATTAGACTTAGCTTCTCGAGAAGCTAAGTCTAATGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2189s1c1
Sequence:CCGGGCCTCCGTGTACCAAGAAATTCTCGAGAATTTCTTGGTACACGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-3732s1c1
Sequence:CCGGGCCAAGATTCAGCAATGTCAACTCGAGTTGACATTGCTGAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2001s1c1
Sequence:CCGGCGGAACAAATCTAAGATGAAACTCGAGTTTCATCTTAGATTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012026.2-5336s21c1
Sequence:CCGGATATCCCATGCACGTTCAATTCTCGAGAATTGAACGTGCATGGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-1255s21c1
Sequence:CCGGGCGATTTGGATATCAACTATACTCGAGTATAGTTGATATCCAAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-896s21c1
Sequence:CCGGCATCAAACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-3178s21c1
Sequence:CCGGGCAAAGCTCTCGGCTTAATTACTCGAGTAATTAAGCCGAGAGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012026
ARHGEF28 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 28
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012026.1-5202s1c1
Sequence:CCGGCCTCTGATTGTGTGGCCATTTCTCGAGAAATGGCCACACAATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-703s1c1
Sequence:CCGGCCACACCATTAGACTTAGCTTCTCGAGAAGCTAAGTCTAATGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2189s1c1
Sequence:CCGGGCCTCCGTGTACCAAGAAATTCTCGAGAATTTCTTGGTACACGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-3732s1c1
Sequence:CCGGGCCAAGATTCAGCAATGTCAACTCGAGTTGACATTGCTGAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012026.1-2001s1c1
Sequence:CCGGCGGAACAAATCTAAGATGAAACTCGAGTTTCATCTTAGATTTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012026.2-5336s21c1
Sequence:CCGGATATCCCATGCACGTTCAATTCTCGAGAATTGAACGTGCATGGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-1255s21c1
Sequence:CCGGGCGATTTGGATATCAACTATACTCGAGTATAGTTGATATCCAAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-896s21c1
Sequence:CCGGCATCAAACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012026.2-3178s21c1
Sequence:CCGGGCAAAGCTCTCGGCTTAATTACTCGAGTAATTAAGCCGAGAGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080479
VALIDATED
ARHGEF28 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-3166s21c1
Sequence:CCGGTGTTGGTCACTCAGCGTATTACTCGAGTAATACGCTGAGTGACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-1881s21c1
Sequence:CCGGACTCGTTTGGTGCGTGAATTACTCGAGTAATTCACGCACCAAACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-2064s21c1
Sequence:CCGGATGACTAGCCCTCGGAATAAACTCGAGTTTATTCCGAGGGCTAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1202s21c1
Sequence:CCGGTCGCTCCTTCGATATCCTAAACTCGAGTTTAGGATATCGAAGGAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1329s21c1
Sequence:CCGGGATTTGGATATCAGCTATATTCTCGAGAATATAGCTGATATCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080479
VALIDATED
ARHGEF28 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-3166s21c1
Sequence:CCGGTGTTGGTCACTCAGCGTATTACTCGAGTAATACGCTGAGTGACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-1881s21c1
Sequence:CCGGACTCGTTTGGTGCGTGAATTACTCGAGTAATTCACGCACCAAACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-2064s21c1
Sequence:CCGGATGACTAGCCCTCGGAATAAACTCGAGTTTATTCCGAGGGCTAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1202s21c1
Sequence:CCGGTCGCTCCTTCGATATCCTAAACTCGAGTTTAGGATATCGAAGGAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1329s21c1
Sequence:CCGGGATTTGGATATCAGCTATATTCTCGAGAATATAGCTGATATCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080479
VALIDATED
ARHGEF28 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-3166s21c1
Sequence:CCGGTGTTGGTCACTCAGCGTATTACTCGAGTAATACGCTGAGTGACCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-1881s21c1
Sequence:CCGGACTCGTTTGGTGCGTGAATTACTCGAGTAATTCACGCACCAAACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080479.1-2064s21c1
Sequence:CCGGATGACTAGCCCTCGGAATAAACTCGAGTTTATTCCGAGGGCTAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1202s21c1
Sequence:CCGGTCGCTCCTTCGATATCCTAAACTCGAGTTTAGGATATCGAAGGAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080479.1-1329s21c1
Sequence:CCGGGATTTGGATATCAGCTATATTCTCGAGAATATAGCTGATATCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)