EMAIL THIS PAGE TO A FRIEND

ARHGEF2

Rho/Rac guanine nucleotide exchange factor (GEF) 2

139 Gene Product Result for
Synonyms: GEF GEF-H1 GEFH1 LFP40 P40
Gene ID:
Human(9181) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
Mouse(16800) rho/rac guanine nucleotide exchange factor (GEF) 2
Rat(310635) rho/rac guanine nucleotide exchange factor (GEF) 2
Zebrafish(561276) rho/rac guanine nucleotide exchange factor (GEF) 2
cow(505940) Rho/Rac guanine nucleotide exchange factor (GEF) 2
Horse(100057582) Rho/Rac guanine nucleotide exchange factor (GEF) 2
domestic cat(101087196) Rho/Rac guanine nucleotide exchange factor (GEF) 2
dog(403498) Rho/Rac guanine nucleotide exchange factor (GEF) 2
domestic guinea pig(100719625) Rho/Rac guanine nucleotide exchange factor (GEF) 2
naked mole-rat(101698496) Rho/Rac guanine nucleotide exchange factor (GEF) 2
sheep(101121729) Rho/Rac guanine nucleotide exchange factor (GEF) 2
Domestic Rabbit(100346634) Rho/Rac guanine nucleotide exchange factor (GEF) 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100673 Anti-ARHGEF2 (451-465) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1100674 Anti-ARHGEF2 (641-655) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA017046 Anti-ARHGEF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB4503579 Anti-ARHGEF2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA043437 Anti-ARHGEF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
SAB4503578 Anti-ARHGEF2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504318 Anti-phospho-Rho/Rac Guanine Nucleotide Exchange Factor 2 (pSer885) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB2702237 Monoclonal Anti-GEF-H1 antibody produced in mouse clone GT336, affinity isolated antibody rat, mouse, human
western blot pricing
SAB2702238 Monoclonal Anti-GEF-H1 antibody produced in mouse clone GT1132, affinity isolated antibody rat, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004723 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092941 MISSION® esiRNA esiRNA human ARHGEF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004723 Rosetta Predictions human pricing
NM_001012079 Rosetta Predictions rat pricing
XM_574974 Rosetta Predictions rat pricing
NM_008487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338197 predicted 657
2 SASI_Hs01_00019242 predicted 3063
3 SASI_Hs01_00019243 predicted 1200
4 SASI_Hs01_00019244 predicted 557
5 SASI_Hs01_00019245 predicted 1061
6 SASI_Hs01_00019246 predicted 2145
7 SASI_Hs01_00019247 predicted 1786
8 SASI_Hs01_00019248 predicted 480
9 SASI_Hs01_00019249 predicted 2909
10 SASI_Hs02_00338198 predicted 1852
11 SASI_Hs01_00019250 predicted 1519
12 SASI_Hs01_00019251 predicted 3020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101464 predicted 544
2 SASI_Rn01_00101466 predicted 957
3 SASI_Rn01_00101468 predicted 1120
4 SASI_Rn01_00101469 predicted 614
5 SASI_Rn01_00101470 predicted 645
6 SASI_Rn01_00101471 predicted 1760
7 SASI_Rn02_00200200 predicted 2902
8 SASI_Rn01_00101472 predicted 934
9 SASI_Rn01_00101473 predicted 2798
10 SASI_Rn02_00200201 predicted 1243
11 SASI_Rn01_00101465 predicted 1578
12 SASI_Rn01_00101467 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161350 predicted 587
2 SASI_Rn01_00161351 predicted 1619
3 SASI_Rn01_00161352 predicted 995
4 SASI_Rn01_00161353 predicted 1276
5 SASI_Rn01_00161354 predicted 1172
6 SASI_Rn01_00161355 predicted 657
7 SASI_Rn01_00161356 predicted 689
8 SASI_Rn01_00161357 predicted 1795
9 SASI_Rn01_00161358 predicted 981
10 SASI_Rn01_00161359 predicted 2842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087177 predicted 855
2 SASI_Mm02_00314012 predicted 3179
3 SASI_Mm01_00087179 predicted 1192
4 SASI_Mm02_00314013 predicted 3139
5 SASI_Mm02_00314014 predicted 681
6 SASI_Mm01_00087181 predicted 1912
7 SASI_Mm01_00087182 predicted 1026
8 SASI_Mm01_00087183 predicted 1012
9 SASI_Mm02_00314015 predicted 606
10 SASI_Mm01_00087184 predicted 2872
11 SASI_Mm01_00087178 predicted 583
12 SASI_Mm01_00087180 predicted 689
13 SASI_Mm01_00087185 predicted 2245
14 SASI_Mm01_00087186 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008487
ARHGEF2 MISSION shRNA Bacterial Glycerol Stock
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-707s21c1
Sequence:CCGGTGTCCGTGGAATCCCTTATTGCTCGAGCAATAAGGGATTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-243s21c1
Sequence:CCGGAGCTAAAGATGCCCGCTATACCTCGAGGTATAGCGGGCATCTTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-2367s21c1
Sequence:CCGGACAGCCATTGATCAATCTTTACTCGAGTAAAGATTGATCAATGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1449s1c1
Sequence:CCGGGCAGGAGATTTACAACCGAATCTCGAGATTCGGTTGTAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-2787s1c1
Sequence:CCGGCGACGCTTTATACTTGAGCTTCTCGAGAAGCTCAAGTATAAAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-314s1c1
Sequence:CCGGCCCTCATTTGTCCTACATGTACTCGAGTACATGTAGGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-980s1c1
Sequence:CCGGTCAGTGACATTCACACACGTTCTCGAGAACGTGTGTGAATGTCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1759s1c1
Sequence:CCGGCCTGAGATGTATGAGGTACATCTCGAGATGTACCTCATACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008487
ARHGEF2 MISSION shRNA shRNA Plasmid DNA
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-707s21c1
Sequence:CCGGTGTCCGTGGAATCCCTTATTGCTCGAGCAATAAGGGATTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-243s21c1
Sequence:CCGGAGCTAAAGATGCCCGCTATACCTCGAGGTATAGCGGGCATCTTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-2367s21c1
Sequence:CCGGACAGCCATTGATCAATCTTTACTCGAGTAAAGATTGATCAATGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1449s1c1
Sequence:CCGGGCAGGAGATTTACAACCGAATCTCGAGATTCGGTTGTAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-2787s1c1
Sequence:CCGGCGACGCTTTATACTTGAGCTTCTCGAGAAGCTCAAGTATAAAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-314s1c1
Sequence:CCGGCCCTCATTTGTCCTACATGTACTCGAGTACATGTAGGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-980s1c1
Sequence:CCGGTCAGTGACATTCACACACGTTCTCGAGAACGTGTGTGAATGTCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1759s1c1
Sequence:CCGGCCTGAGATGTATGAGGTACATCTCGAGATGTACCTCATACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008487
ARHGEF2 MISSION shRNA Lentiviral Transduction Particles
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-707s21c1
Sequence:CCGGTGTCCGTGGAATCCCTTATTGCTCGAGCAATAAGGGATTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-243s21c1
Sequence:CCGGAGCTAAAGATGCCCGCTATACCTCGAGGTATAGCGGGCATCTTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008487.3-2367s21c1
Sequence:CCGGACAGCCATTGATCAATCTTTACTCGAGTAAAGATTGATCAATGGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1449s1c1
Sequence:CCGGGCAGGAGATTTACAACCGAATCTCGAGATTCGGTTGTAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-2787s1c1
Sequence:CCGGCGACGCTTTATACTTGAGCTTCTCGAGAAGCTCAAGTATAAAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-314s1c1
Sequence:CCGGCCCTCATTTGTCCTACATGTACTCGAGTACATGTAGGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-980s1c1
Sequence:CCGGTCAGTGACATTCACACACGTTCTCGAGAACGTGTGTGAATGTCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008487.2-1759s1c1
Sequence:CCGGCCTGAGATGTATGAGGTACATCTCGAGATGTACCTCATACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004723
VALIDATED
ARHGEF2 MISSION shRNA Bacterial Glycerol Stock
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-1798s1c1
Sequence:CCGGGCGGCGAATTAAGATGGAGTTCTCGAGAACTCCATCTTAATTCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004723.x-3727s1c1
Sequence:CCGGCGTAGGCAATTAGAGATCGAACTCGAGTTCGATCTCTAATTGCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2698s1c1
Sequence:CCGGCGATGCCCTGTACTTGAGTTTCTCGAGAAACTCAAGTACAGGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004723.x-235s1c1
Sequence:CCGGCCCAACCTGCAATGTGACTATCTCGAGATAGTCACATTGCAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2774s1c1
Sequence:CCGGCGCTCTGTCCATCGAAACTTTCTCGAGAAAGTTTCGATGGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004723
VALIDATED
ARHGEF2 MISSION shRNA shRNA Plasmid DNA
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-1798s1c1
Sequence:CCGGGCGGCGAATTAAGATGGAGTTCTCGAGAACTCCATCTTAATTCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004723.x-3727s1c1
Sequence:CCGGCGTAGGCAATTAGAGATCGAACTCGAGTTCGATCTCTAATTGCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2698s1c1
Sequence:CCGGCGATGCCCTGTACTTGAGTTTCTCGAGAAACTCAAGTACAGGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004723.x-235s1c1
Sequence:CCGGCCCAACCTGCAATGTGACTATCTCGAGATAGTCACATTGCAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2774s1c1
Sequence:CCGGCGCTCTGTCCATCGAAACTTTCTCGAGAAAGTTTCGATGGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004723
VALIDATED
ARHGEF2 MISSION shRNA Lentiviral Transduction Particles
Rho/Rac guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-1798s1c1
Sequence:CCGGGCGGCGAATTAAGATGGAGTTCTCGAGAACTCCATCTTAATTCGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004723.x-3727s1c1
Sequence:CCGGCGTAGGCAATTAGAGATCGAACTCGAGTTCGATCTCTAATTGCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2698s1c1
Sequence:CCGGCGATGCCCTGTACTTGAGTTTCTCGAGAAACTCAAGTACAGGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004723.x-235s1c1
Sequence:CCGGCCCAACCTGCAATGTGACTATCTCGAGATAGTCACATTGCAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004723.x-2774s1c1
Sequence:CCGGCGCTCTGTCCATCGAAACTTTCTCGAGAAAGTTTCGATGGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks