EMAIL THIS PAGE TO A FRIEND

ARHGEF33

Rho guanine nucleotide exchange factor (GEF) 33

22 Gene Product Result for
UniProtKB ID: A8MVX0, J3KPX2
Gene ID:
Mouse(381112) Rho guanine nucleotide exchange factor (GEF) 33
chicken(425963) Rho guanine nucleotide exchange factor (GEF) 33
domestic cat(101099115) Rho guanine nucleotide exchange factor (GEF) 33
dog(483041) Rho guanine nucleotide exchange factor (GEF) 33
cow(100335703) Rho guanine nucleotide exchange factor (GEF) 33
sheep(101119128) Rho guanine nucleotide exchange factor (GEF) 33
naked mole-rat(101706185) Rho guanine nucleotide exchange factor (GEF) 33
domestic guinea pig(100715429) Rho guanine nucleotide exchange factor (GEF) 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222531 MISSION® esiRNA esiRNA targeting human ARHGEF33 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_889779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276578 predicted 1355
2 SASI_Mm01_00276579 predicted 1680
3 SASI_Mm01_00276580 predicted 1755
4 SASI_Mm01_00276581 predicted 1505
5 SASI_Mm01_00276582 predicted 1676
6 SASI_Mm01_00276583 predicted 1607
7 SASI_Mm01_00276584 predicted 1563
8 SASI_Mm01_00276585 predicted 1712
9 SASI_Mm01_00276586 predicted 1782
10 SASI_Mm01_00276587 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145451
ARHGEF33 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 33
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145451.1-2766s21c1
Sequence:CCGGTCTACCAAATGTAGCATATATCTCGAGATATATGCTACATTTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1280s21c1
Sequence:CCGGTCCAGCGCCTCCGAGTATTTACTCGAGTAAATACTCGGAGGCGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-50s21c1
Sequence:CCGGATAATCCTTCCACGCAGATTTCTCGAGAAATCTGCGTGGAAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1037s21c1
Sequence:CCGGAGTTAACAAATGACGAGAATACTCGAGTATTCTCGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1243s21c1
Sequence:CCGGCAGGAGCACCCTGACTATTATCTCGAGATAATAGTCAGGGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145451
ARHGEF33 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 33
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145451.1-2766s21c1
Sequence:CCGGTCTACCAAATGTAGCATATATCTCGAGATATATGCTACATTTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1280s21c1
Sequence:CCGGTCCAGCGCCTCCGAGTATTTACTCGAGTAAATACTCGGAGGCGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-50s21c1
Sequence:CCGGATAATCCTTCCACGCAGATTTCTCGAGAAATCTGCGTGGAAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1037s21c1
Sequence:CCGGAGTTAACAAATGACGAGAATACTCGAGTATTCTCGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1243s21c1
Sequence:CCGGCAGGAGCACCCTGACTATTATCTCGAGATAATAGTCAGGGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145451
ARHGEF33 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 33
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145451.1-2766s21c1
Sequence:CCGGTCTACCAAATGTAGCATATATCTCGAGATATATGCTACATTTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1280s21c1
Sequence:CCGGTCCAGCGCCTCCGAGTATTTACTCGAGTAAATACTCGGAGGCGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-50s21c1
Sequence:CCGGATAATCCTTCCACGCAGATTTCTCGAGAAATCTGCGTGGAAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1037s21c1
Sequence:CCGGAGTTAACAAATGACGAGAATACTCGAGTATTCTCGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145451.1-1243s21c1
Sequence:CCGGCAGGAGCACCCTGACTATTATCTCGAGATAATAGTCAGGGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145452
ARHGEF33 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1499s21c1
Sequence:CCGGTTCAGCGCCTCCGAGTGTTTACTCGAGTAAACACTCGGAGGCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1295s21c1
Sequence:CCGGTCGCCTACCTGAGGGATTTACCTCGAGGTAAATCCCTCAGGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-227s21c1
Sequence:CCGGATGAACACATGCCGGTGAATACTCGAGTATTCACCGGCATGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145452.1-3073s21c1
Sequence:CCGGTGAAGATTAGTCTATGGTTAACTCGAGTTAACCATAGACTAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1461s21c1
Sequence:CCGGGCAGGAGCACCCAGACTATTACTCGAGTAATAGTCTGGGTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145452
ARHGEF33 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1499s21c1
Sequence:CCGGTTCAGCGCCTCCGAGTGTTTACTCGAGTAAACACTCGGAGGCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1295s21c1
Sequence:CCGGTCGCCTACCTGAGGGATTTACCTCGAGGTAAATCCCTCAGGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-227s21c1
Sequence:CCGGATGAACACATGCCGGTGAATACTCGAGTATTCACCGGCATGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145452.1-3073s21c1
Sequence:CCGGTGAAGATTAGTCTATGGTTAACTCGAGTTAACCATAGACTAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1461s21c1
Sequence:CCGGGCAGGAGCACCCAGACTATTACTCGAGTAATAGTCTGGGTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145452
ARHGEF33 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1499s21c1
Sequence:CCGGTTCAGCGCCTCCGAGTGTTTACTCGAGTAAACACTCGGAGGCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1295s21c1
Sequence:CCGGTCGCCTACCTGAGGGATTTACCTCGAGGTAAATCCCTCAGGTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-227s21c1
Sequence:CCGGATGAACACATGCCGGTGAATACTCGAGTATTCACCGGCATGTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145452.1-3073s21c1
Sequence:CCGGTGAAGATTAGTCTATGGTTAACTCGAGTTAACCATAGACTAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145452.1-1461s21c1
Sequence:CCGGGCAGGAGCACCCAGACTATTACTCGAGTAATAGTCTGGGTGCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks