EMAIL THIS PAGE TO A FRIEND

ARHGEF35

Rho guanine nucleotide exchange factor (GEF) 35

19 Gene Product Result for
Synonyms: ARHGEF5L
Species: Human ARHGEF35(445328)
UniProtKB ID: A5YM69, Q6ZUI2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084954 predicted 893
2 SASI_Hs01_00084955 predicted 500
3 SASI_Hs01_00084956 predicted 627
4 SASI_Hs01_00084957 predicted 282
5 SASI_Hs01_00084958 predicted 574
6 SASI_Hs01_00084960 predicted 896
7 SASI_Hs01_00084961 predicted 251
8 SASI_Hs01_00084963 predicted 893
9 SASI_Hs02_00304341 predicted 346
10 SASI_Hs02_00304342 predicted 1194
11 SASI_Hs01_00084959 predicted 580
12 SASI_Hs01_00084962 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003702
ARHGEF35 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 35
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1628s1c1
Sequence:CCGGGACTTCTTTGACTGATAGATTCTCGAGAATCTATCAGTCAAAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-290s1c1
Sequence:CCGGGCAACTCAGCAGAGTGAGTTACTCGAGTAACTCACTCTGCTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-1307s1c1
Sequence:CCGGGAAGAGGAGAATGAGCATCATCTCGAGATGATGCTCATTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-896s1c1
Sequence:CCGGCAGATGATAGAGCAGGTTAATCTCGAGATTAACCTGCTCTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1709s1c1
Sequence:CCGGGATTTCCAATTGGATTCCCTACTCGAGTAGGGAATCCAATTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1623s1c1
Sequence:CCGGCTTGAGACTTCTTTGACTGATCTCGAGATCAGTCAAAGAAGTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-579s1c1
Sequence:CCGGCAGGACTTACTTCTTTGACATCTCGAGATGTCAAAGAAGTAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003702
ARHGEF35 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 35
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1628s1c1
Sequence:CCGGGACTTCTTTGACTGATAGATTCTCGAGAATCTATCAGTCAAAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-290s1c1
Sequence:CCGGGCAACTCAGCAGAGTGAGTTACTCGAGTAACTCACTCTGCTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-1307s1c1
Sequence:CCGGGAAGAGGAGAATGAGCATCATCTCGAGATGATGCTCATTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-896s1c1
Sequence:CCGGCAGATGATAGAGCAGGTTAATCTCGAGATTAACCTGCTCTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1709s1c1
Sequence:CCGGGATTTCCAATTGGATTCCCTACTCGAGTAGGGAATCCAATTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1623s1c1
Sequence:CCGGCTTGAGACTTCTTTGACTGATCTCGAGATCAGTCAAAGAAGTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-579s1c1
Sequence:CCGGCAGGACTTACTTCTTTGACATCTCGAGATGTCAAAGAAGTAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003702
ARHGEF35 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 35
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1628s1c1
Sequence:CCGGGACTTCTTTGACTGATAGATTCTCGAGAATCTATCAGTCAAAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-290s1c1
Sequence:CCGGGCAACTCAGCAGAGTGAGTTACTCGAGTAACTCACTCTGCTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-1307s1c1
Sequence:CCGGGAAGAGGAGAATGAGCATCATCTCGAGATGATGCTCATTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-896s1c1
Sequence:CCGGCAGATGATAGAGCAGGTTAATCTCGAGATTAACCTGCTCTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1709s1c1
Sequence:CCGGGATTTCCAATTGGATTCCCTACTCGAGTAGGGAATCCAATTGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003702.1-1623s1c1
Sequence:CCGGCTTGAGACTTCTTTGACTGATCTCGAGATCAGTCAAAGAAGTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003702.1-579s1c1
Sequence:CCGGCAGGACTTACTTCTTTGACATCTCGAGATGTCAAAGAAGTAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks