EMAIL THIS PAGE TO A FRIEND

ARHGEF37

Rho guanine nucleotide exchange factor (GEF) 37

UniProtKB ID: A1IGU5, Q6ZW51
Gene ID:
Mouse(328967) Rho guanine nucleotide exchange factor (GEF) 37
Rat(307398) Rho guanine nucleotide exchange factor (GEF) 37
chicken(416149) Rho guanine nucleotide exchange factor (GEF) 37
cow(526631) Rho guanine nucleotide exchange factor (GEF) 37
domestic cat(101085350) Rho guanine nucleotide exchange factor (GEF) 37
dog(489191) Rho guanine nucleotide exchange factor (GEF) 37
domestic guinea pig(100724510) Rho guanine nucleotide exchange factor (GEF) 37
naked mole-rat(101716170) Rho guanine nucleotide exchange factor (GEF) 37
sheep(101121007) Rho guanine nucleotide exchange factor (GEF) 37
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001669 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU180351 MISSION® esiRNA esiRNA targeting mouse Arhgef37 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001669 Rosetta Predictions human pricing
NM_001100974 Rosetta Predictions rat pricing
NM_177828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101295 predicted 2085
2 SASI_Hs01_00101296 predicted 719
3 SASI_Hs01_00101297 predicted 850
4 SASI_Hs01_00101298 predicted 2020
5 SASI_Hs01_00101299 predicted 1280
6 SASI_Hs01_00101300 predicted 935
7 SASI_Hs01_00101301 predicted 1650
8 SASI_Hs01_00101302 predicted 1055
9 SASI_Hs01_00101303 predicted 350
10 SASI_Hs01_00101304 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210882 predicted 1828
2 SASI_Rn02_00210883 predicted 415
3 SASI_Rn02_00210884 predicted 1818
4 SASI_Rn02_00210885 predicted 316
5 SASI_Rn02_00210886 predicted 938
6 SASI_Rn02_00210887 predicted 1615
7 SASI_Rn02_00210888 predicted 1326
8 SASI_Rn02_00210889 predicted 1126
9 SASI_Rn02_00210890 predicted 1708
10 SASI_Rn02_00210891 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348285 predicted 486
2 SASI_Mm01_00034508 predicted 1154
3 SASI_Mm02_00348286 predicted 271
4 SASI_Mm01_00034509 predicted 1565
5 SASI_Mm02_00348287 predicted 488
6 SASI_Mm01_00034512 predicted 1378
7 SASI_Mm01_00034513 predicted 776
8 SASI_Mm01_00034514 predicted 1744
9 SASI_Mm01_00034515 predicted 938
10 SASI_Mm02_00348288 predicted 383
11 SASI_Mm01_00034507 predicted 1056
12 SASI_Mm01_00034510 predicted 486
13 SASI_Mm01_00034511 predicted 1070
14 SASI_Mm01_00034516 predicted 2058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001669
ARHGEF37 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 37
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000454977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-678s21c1
Sequence:CCGGACGTGAACACCAATATCAATGCTCGAGCATTGATATTGGTGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-366s21c1
Sequence:CCGGAGCTAGTTGGTAACATATTTCCTCGAGGAAATATGTTACCAACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001669
ARHGEF37 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 37
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000454977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-678s21c1
Sequence:CCGGACGTGAACACCAATATCAATGCTCGAGCATTGATATTGGTGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-366s21c1
Sequence:CCGGAGCTAGTTGGTAACATATTTCCTCGAGGAAATATGTTACCAACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001669
ARHGEF37 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 37
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000454977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-678s21c1
Sequence:CCGGACGTGAACACCAATATCAATGCTCGAGCATTGATATTGGTGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001669.2-366s21c1
Sequence:CCGGAGCTAGTTGGTAACATATTTCCTCGAGGAAATATGTTACCAACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177828
ARHGEF37 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 37
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177828.2-2429s1c1
Sequence:CCGGCAAAGGAACTTGGCAGTCAATCTCGAGATTGACTGCCAAGTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-605s1c1
Sequence:CCGGCGGCAATATCAACGAATACAACTCGAGTTGTATTCGTTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-693s1c1
Sequence:CCGGCGCATCAACACACATACTCTTCTCGAGAAGAGTATGTGTGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-1517s1c1
Sequence:CCGGCCAGGTGTCAAGCAACATCAACTCGAGTTGATGTTGCTTGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-771s1c1
Sequence:CCGGCGGACAGAAGACAAGGAATTTCTCGAGAAATTCCTTGTCTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177828
ARHGEF37 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 37
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177828.2-2429s1c1
Sequence:CCGGCAAAGGAACTTGGCAGTCAATCTCGAGATTGACTGCCAAGTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-605s1c1
Sequence:CCGGCGGCAATATCAACGAATACAACTCGAGTTGTATTCGTTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-693s1c1
Sequence:CCGGCGCATCAACACACATACTCTTCTCGAGAAGAGTATGTGTGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-1517s1c1
Sequence:CCGGCCAGGTGTCAAGCAACATCAACTCGAGTTGATGTTGCTTGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-771s1c1
Sequence:CCGGCGGACAGAAGACAAGGAATTTCTCGAGAAATTCCTTGTCTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177828
ARHGEF37 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 37
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177828.2-2429s1c1
Sequence:CCGGCAAAGGAACTTGGCAGTCAATCTCGAGATTGACTGCCAAGTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-605s1c1
Sequence:CCGGCGGCAATATCAACGAATACAACTCGAGTTGTATTCGTTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-693s1c1
Sequence:CCGGCGCATCAACACACATACTCTTCTCGAGAAGAGTATGTGTGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-1517s1c1
Sequence:CCGGCCAGGTGTCAAGCAACATCAACTCGAGTTGATGTTGCTTGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177828.2-771s1c1
Sequence:CCGGCGGACAGAAGACAAGGAATTTCTCGAGAAATTCCTTGTCTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371776
ARHGEF37 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-989s1c1
Sequence:CCGGGAAGAACAACGTGGCTGCTTACTCGAGTAAGCAGCCACGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-1211s1c1
Sequence:CCGGGATCAAGAAGCGTCTGGACAACTCGAGTTGTCCAGACGCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-4291s1c1
Sequence:CCGGGCTAGTTCAAACAGGCGCTTTCTCGAGAAAGCGCCTGTTTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-339s1c1
Sequence:CCGGGTCCTGTTCTCAAACATTGATCTCGAGATCAATGTTTGAGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-3391s1c1
Sequence:CCGGCCAGCCTCTTTAACTTGGTAACTCGAGTTACCAAGTTAAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1127s1c1
Sequence:CCGGCCTGAAATTTAAGCAACGGCTCTCGAGAGCCGTTGCTTAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1046s1c1
Sequence:CCGGGCACGAATACAATCTGGACATCTCGAGATGTCCAGATTGTATTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-610s1c1
Sequence:CCGGGCCTCAGTTTCTTGCTGGTAACTCGAGTTACCAGCAAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371776
ARHGEF37 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-989s1c1
Sequence:CCGGGAAGAACAACGTGGCTGCTTACTCGAGTAAGCAGCCACGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-1211s1c1
Sequence:CCGGGATCAAGAAGCGTCTGGACAACTCGAGTTGTCCAGACGCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-4291s1c1
Sequence:CCGGGCTAGTTCAAACAGGCGCTTTCTCGAGAAAGCGCCTGTTTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-339s1c1
Sequence:CCGGGTCCTGTTCTCAAACATTGATCTCGAGATCAATGTTTGAGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-3391s1c1
Sequence:CCGGCCAGCCTCTTTAACTTGGTAACTCGAGTTACCAAGTTAAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1127s1c1
Sequence:CCGGCCTGAAATTTAAGCAACGGCTCTCGAGAGCCGTTGCTTAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1046s1c1
Sequence:CCGGGCACGAATACAATCTGGACATCTCGAGATGTCCAGATTGTATTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-610s1c1
Sequence:CCGGGCCTCAGTTTCTTGCTGGTAACTCGAGTTACCAGCAAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371776
ARHGEF37 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-989s1c1
Sequence:CCGGGAAGAACAACGTGGCTGCTTACTCGAGTAAGCAGCCACGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-1211s1c1
Sequence:CCGGGATCAAGAAGCGTCTGGACAACTCGAGTTGTCCAGACGCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-4291s1c1
Sequence:CCGGGCTAGTTCAAACAGGCGCTTTCTCGAGAAAGCGCCTGTTTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-339s1c1
Sequence:CCGGGTCCTGTTCTCAAACATTGATCTCGAGATCAATGTTTGAGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371776.1-3391s1c1
Sequence:CCGGCCAGCCTCTTTAACTTGGTAACTCGAGTTACCAAGTTAAAGAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1127s1c1
Sequence:CCGGCCTGAAATTTAAGCAACGGCTCTCGAGAGCCGTTGCTTAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371776.1-1046s1c1
Sequence:CCGGGCACGAATACAATCTGGACATCTCGAGATGTCCAGATTGTATTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371776.1-610s1c1
Sequence:CCGGGCCTCAGTTTCTTGCTGGTAACTCGAGTTACCAGCAAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks