EMAIL THIS PAGE TO A FRIEND

ARHGEF38

Rho guanine nucleotide exchange factor (GEF) 38

47 Gene Product Result for
UniProtKB ID: Q9NXL2, C9JIB4
Gene ID:
Mouse(77669) Rho guanine nucleotide exchange factor (GEF) 38
sheep(101104491) Rho guanine nucleotide exchange factor (GEF) 38
naked mole-rat(101722052) Rho guanine nucleotide exchange factor (GEF) 38
domestic guinea pig(100713087) Rho guanine nucleotide exchange factor (GEF) 38
Zebrafish(100317614) Rho guanine nucleotide exchange factor (GEF) 38
chicken(428744) Rho guanine nucleotide exchange factor (GEF) 38
dog(487888) Rho guanine nucleotide exchange factor (GEF) 38
cow(618404) Rho guanine nucleotide exchange factor (GEF) 38
domestic cat(101092603) Rho guanine nucleotide exchange factor (GEF) 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017700 Rosetta Predictions human pricing
NM_029953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099601 predicted 462
2 SASI_Hs02_00350456 predicted 636
3 SASI_Hs01_00099602 predicted 542
4 SASI_Hs01_00099604 predicted 786
5 SASI_Hs01_00099605 predicted 540
6 SASI_Hs01_00099607 predicted 874
7 SASI_Hs01_00099608 predicted 857
8 SASI_Hs02_00350457 predicted 638
9 SASI_Hs02_00350458 predicted 295
10 SASI_Hs02_00350459 predicted 864
11 SASI_Hs01_00099603 predicted 482
12 SASI_Hs01_00099606 predicted 784
13 SASI_Hs01_00099609 predicted 727
14 SASI_Hs01_00099610 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026897 predicted 277
2 SASI_Mm01_00026898 predicted 563
3 SASI_Mm01_00026899 predicted 652
4 SASI_Mm01_00026900 predicted 379
5 SASI_Mm01_00026901 predicted 708
6 SASI_Mm01_00026902 predicted 560
7 SASI_Mm01_00026903 predicted 364
8 SASI_Mm01_00026904 predicted 315
9 SASI_Mm01_00026905 predicted 224
10 SASI_Mm01_00026906 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017700
ARHGEF38 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 38
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-305s21c1
Sequence:CCGGCCAATCTGACAGGACCGAATACTCGAGTATTCGGTCCTGTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-657s21c1
Sequence:CCGGGAAGTATTCTTGCAGATTAAACTCGAGTTTAATCTGCAAGAATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017700.1-1158s21c1
Sequence:CCGGCACTGGAGCACATGGGTTAATCTCGAGATTAACCCATGTGCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-210s21c1
Sequence:CCGGTTGAGGTCTAGACTCTATATGCTCGAGCATATAGAGTCTAGACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-632s21c1
Sequence:CCGGGGAACCGGCCATGCAAGTAATCTCGAGATTACTTGCATGGCCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-729s1c1
Sequence:CCGGCATAGTATACTGGAGTCCTATCTCGAGATAGGACTCCAGTATACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-317s1c1
Sequence:CCGGGACCGAATACAACCAGAAATTCTCGAGAATTTCTGGTTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017700
ARHGEF38 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 38
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-305s21c1
Sequence:CCGGCCAATCTGACAGGACCGAATACTCGAGTATTCGGTCCTGTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-657s21c1
Sequence:CCGGGAAGTATTCTTGCAGATTAAACTCGAGTTTAATCTGCAAGAATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017700.1-1158s21c1
Sequence:CCGGCACTGGAGCACATGGGTTAATCTCGAGATTAACCCATGTGCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-210s21c1
Sequence:CCGGTTGAGGTCTAGACTCTATATGCTCGAGCATATAGAGTCTAGACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-632s21c1
Sequence:CCGGGGAACCGGCCATGCAAGTAATCTCGAGATTACTTGCATGGCCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-729s1c1
Sequence:CCGGCATAGTATACTGGAGTCCTATCTCGAGATAGGACTCCAGTATACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-317s1c1
Sequence:CCGGGACCGAATACAACCAGAAATTCTCGAGAATTTCTGGTTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017700
ARHGEF38 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 38
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-305s21c1
Sequence:CCGGCCAATCTGACAGGACCGAATACTCGAGTATTCGGTCCTGTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-657s21c1
Sequence:CCGGGAAGTATTCTTGCAGATTAAACTCGAGTTTAATCTGCAAGAATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017700.1-1158s21c1
Sequence:CCGGCACTGGAGCACATGGGTTAATCTCGAGATTAACCCATGTGCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-210s21c1
Sequence:CCGGTTGAGGTCTAGACTCTATATGCTCGAGCATATAGAGTCTAGACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017700.1-632s21c1
Sequence:CCGGGGAACCGGCCATGCAAGTAATCTCGAGATTACTTGCATGGCCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-729s1c1
Sequence:CCGGCATAGTATACTGGAGTCCTATCTCGAGATAGGACTCCAGTATACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017700.1-317s1c1
Sequence:CCGGGACCGAATACAACCAGAAATTCTCGAGAATTTCTGGTTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029953
ARHGEF38 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 38
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029953.1-1669s1c1
Sequence:CCGGGCTTTGATAGAAGAAGTCTATCTCGAGATAGACTTCTTCTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-473s1c1
Sequence:CCGGGCTTGTTTAGCAACATTGAATCTCGAGATTCAATGTTGCTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-234s1c1
Sequence:CCGGCAGGACCGAATACAACCAGAACTCGAGTTCTGGTTGTATTCGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029953
ARHGEF38 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 38
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029953.1-1669s1c1
Sequence:CCGGGCTTTGATAGAAGAAGTCTATCTCGAGATAGACTTCTTCTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-473s1c1
Sequence:CCGGGCTTGTTTAGCAACATTGAATCTCGAGATTCAATGTTGCTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-234s1c1
Sequence:CCGGCAGGACCGAATACAACCAGAACTCGAGTTCTGGTTGTATTCGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029953
ARHGEF38 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 38
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029953.1-1669s1c1
Sequence:CCGGGCTTTGATAGAAGAAGTCTATCTCGAGATAGACTTCTTCTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-473s1c1
Sequence:CCGGGCTTGTTTAGCAACATTGAATCTCGAGATTCAATGTTGCTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029953.1-234s1c1
Sequence:CCGGCAGGACCGAATACAACCAGAACTCGAGTTCTGGTTGTATTCGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks