EMAIL THIS PAGE TO A FRIEND

ARHGEF39

Rho guanine nucleotide exchange factor (GEF) 39

178 Gene Product Result for
Synonyms: C9orf100 RP11-331F9.7
UniProtKB ID: Q8N4T4, Q49AG0, Q6TPQ2, Q96ST6
Gene ID:
Mouse(230098) Rho guanine nucleotide exchange factor (GEF) 39
Rat(298404) Rho guanine nucleotide exchange factor (GEF) 39
Zebrafish(492469) Rho guanine nucleotide exchange factor (GEF) 39
cow(780881) Rho guanine nucleotide exchange factor (GEF) 39
domestic cat(101087532) Rho guanine nucleotide exchange factor (GEF) 39
dog(611930) Rho guanine nucleotide exchange factor (GEF) 39
domestic guinea pig(100728616) Rho guanine nucleotide exchange factor (GEF) 39
naked mole-rat(101722434) Rho guanine nucleotide exchange factor (GEF) 39
sheep(101115939) Rho guanine nucleotide exchange factor (GEF) 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032818 Rosetta Predictions human pricing
NM_001106676 Rosetta Predictions rat pricing
NM_001013377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076359 predicted 564
2 SASI_Hs01_00076360 predicted 685
3 SASI_Hs01_00076361 predicted 986
4 SASI_Hs01_00076362 predicted 1004
5 SASI_Hs01_00076363 predicted 421
6 SASI_Hs01_00076364 predicted 402
7 SASI_Hs01_00076365 predicted 679
8 SASI_Hs01_00076366 predicted 626
9 SASI_Hs01_00076367 predicted 588
10 SASI_Hs01_00076368 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221288 predicted 240
2 SASI_Rn02_00221289 predicted 244
3 SASI_Rn02_00221290 predicted 318
4 SASI_Rn02_00221291 predicted 352
5 SASI_Rn02_00221292 predicted 342
6 SASI_Rn02_00221293 predicted 305
7 SASI_Rn02_00221294 predicted 396
8 SASI_Rn02_00221295 predicted 415
9 SASI_Rn02_00221296 predicted 241
10 SASI_Rn02_00221297 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129552 predicted 249
2 SASI_Mm01_00129553 predicted 842
3 SASI_Mm01_00129554 predicted 421
4 SASI_Mm01_00129555 predicted 488
5 SASI_Mm01_00129556 predicted 350
6 SASI_Mm01_00129557 predicted 1031
7 SASI_Mm01_00129559 predicted 1201
8 SASI_Mm02_00287201 predicted 484
9 SASI_Mm01_00129560 predicted 1214
10 SASI_Mm01_00129561 predicted 1199
11 SASI_Mm01_00129558 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032818
VALIDATED
ARHGEF39 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 39
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1024s1c1
Sequence:CCGGCCAACCCAACTAAACCTCAAACTCGAGTTTGAGGTTTAGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1127s1c1
Sequence:CCGGGCAGCTTTGTAAATGTGGCTACTCGAGTAGCCACATTTACAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1028s1c1
Sequence:CCGGCCCAACTAAACCTCAAATGAACTCGAGTTCATTTGAGGTTTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-491s1c1
Sequence:CCGGCCAGCAGTATGAGAATCTCGTCTCGAGACGAGATTCTCATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-501s1c1
Sequence:CCGGGAGAATCTCGTCGTAGCTTTGCTCGAGCAAAGCTACGACGAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-494s1c1
Sequence:CCGGGCAGTATGAGAATCTCGTCGTCTCGAGACGACGAGATTCTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-335s1c1
Sequence:CCGGCCAATTTGCTGCCAACTCAGACTCGAGTCTGAGTTGGCAGCAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-693s21c1
Sequence:CCGGTCCATACTATTGGTCAGAAACCTCGAGGTTTCTGACCAATAGTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-483s21c1
Sequence:CCGGATAAAGGTTTCCGGAGGTTTGCTCGAGCAAACCTCCGGAAACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032818.2-1220s21c1
Sequence:CCGGGATTTGACAAAGGTCACTTTCCTCGAGGAAAGTGACCTTTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-412s21c1
Sequence:CCGGGGAGCTCTATAACCAATTTGCCTCGAGGCAAATTGGTTATAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032818
VALIDATED
ARHGEF39 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 39
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1024s1c1
Sequence:CCGGCCAACCCAACTAAACCTCAAACTCGAGTTTGAGGTTTAGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1127s1c1
Sequence:CCGGGCAGCTTTGTAAATGTGGCTACTCGAGTAGCCACATTTACAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1028s1c1
Sequence:CCGGCCCAACTAAACCTCAAATGAACTCGAGTTCATTTGAGGTTTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-491s1c1
Sequence:CCGGCCAGCAGTATGAGAATCTCGTCTCGAGACGAGATTCTCATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-501s1c1
Sequence:CCGGGAGAATCTCGTCGTAGCTTTGCTCGAGCAAAGCTACGACGAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-494s1c1
Sequence:CCGGGCAGTATGAGAATCTCGTCGTCTCGAGACGACGAGATTCTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-335s1c1
Sequence:CCGGCCAATTTGCTGCCAACTCAGACTCGAGTCTGAGTTGGCAGCAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-693s21c1
Sequence:CCGGTCCATACTATTGGTCAGAAACCTCGAGGTTTCTGACCAATAGTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-483s21c1
Sequence:CCGGATAAAGGTTTCCGGAGGTTTGCTCGAGCAAACCTCCGGAAACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032818.2-1220s21c1
Sequence:CCGGGATTTGACAAAGGTCACTTTCCTCGAGGAAAGTGACCTTTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-412s21c1
Sequence:CCGGGGAGCTCTATAACCAATTTGCCTCGAGGCAAATTGGTTATAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032818
VALIDATED
ARHGEF39 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 39
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1024s1c1
Sequence:CCGGCCAACCCAACTAAACCTCAAACTCGAGTTTGAGGTTTAGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1127s1c1
Sequence:CCGGGCAGCTTTGTAAATGTGGCTACTCGAGTAGCCACATTTACAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-1028s1c1
Sequence:CCGGCCCAACTAAACCTCAAATGAACTCGAGTTCATTTGAGGTTTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-491s1c1
Sequence:CCGGCCAGCAGTATGAGAATCTCGTCTCGAGACGAGATTCTCATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-501s1c1
Sequence:CCGGGAGAATCTCGTCGTAGCTTTGCTCGAGCAAAGCTACGACGAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032818.1-494s1c1
Sequence:CCGGGCAGTATGAGAATCTCGTCGTCTCGAGACGACGAGATTCTCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032818.1-335s1c1
Sequence:CCGGCCAATTTGCTGCCAACTCAGACTCGAGTCTGAGTTGGCAGCAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-693s21c1
Sequence:CCGGTCCATACTATTGGTCAGAAACCTCGAGGTTTCTGACCAATAGTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-483s21c1
Sequence:CCGGATAAAGGTTTCCGGAGGTTTGCTCGAGCAAACCTCCGGAAACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032818.2-1220s21c1
Sequence:CCGGGATTTGACAAAGGTCACTTTCCTCGAGGAAAGTGACCTTTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032818.2-412s21c1
Sequence:CCGGGGAGCTCTATAACCAATTTGCCTCGAGGCAAATTGGTTATAGAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013377
VALIDATED
ARHGEF39 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-426s21c1
Sequence:CCGGAGGAAGGTCGCCCTGAATTTACTCGAGTAAATTCAGGGCGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-940s21c1
Sequence:CCGGCCATGAGAAGCTACTGCTTATCTCGAGATAAGCAGTAGCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-324s21c1
Sequence:CCGGTGGAGCTCTACGCCCAATTTGCTCGAGCAAATTGGGCGTAGAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-1275s21c1
Sequence:CCGGTGTCTGTGGCCAGCGGTTAATCTCGAGATTAACCGCTGGCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-489s21c1
Sequence:CCGGGGCTCCAACAGTACGAGAATCCTCGAGGATTCTCGTACTGTTGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013377
VALIDATED
ARHGEF39 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-426s21c1
Sequence:CCGGAGGAAGGTCGCCCTGAATTTACTCGAGTAAATTCAGGGCGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-940s21c1
Sequence:CCGGCCATGAGAAGCTACTGCTTATCTCGAGATAAGCAGTAGCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-324s21c1
Sequence:CCGGTGGAGCTCTACGCCCAATTTGCTCGAGCAAATTGGGCGTAGAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-1275s21c1
Sequence:CCGGTGTCTGTGGCCAGCGGTTAATCTCGAGATTAACCGCTGGCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-489s21c1
Sequence:CCGGGGCTCCAACAGTACGAGAATCCTCGAGGATTCTCGTACTGTTGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013377
VALIDATED
ARHGEF39 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-426s21c1
Sequence:CCGGAGGAAGGTCGCCCTGAATTTACTCGAGTAAATTCAGGGCGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-940s21c1
Sequence:CCGGCCATGAGAAGCTACTGCTTATCTCGAGATAAGCAGTAGCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-324s21c1
Sequence:CCGGTGGAGCTCTACGCCCAATTTGCTCGAGCAAATTGGGCGTAGAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013377.1-1275s21c1
Sequence:CCGGTGTCTGTGGCCAGCGGTTAATCTCGAGATTAACCGCTGGCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013377.1-489s21c1
Sequence:CCGGGGCTCCAACAGTACGAGAATCCTCGAGGATTCTCGTACTGTTGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks