EMAIL THIS PAGE TO A FRIEND

ARHGEF3

Rho guanine nucleotide exchange factor (GEF) 3

182 Gene Product Result for
Synonyms: GEF3 STA3 XPLN
Gene ID:
Human(50650) Summary: Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71704) Rho guanine nucleotide exchange factor (GEF) 3
Rat(290541) Rho guanine nucleotide exchange factor (GEF) 3
domestic guinea pig(100725004) Rho guanine nucleotide exchange factor (GEF) 3
naked mole-rat(101705127) Rho guanine nucleotide exchange factor (GEF) 3
sheep(101103763) Rho guanine nucleotide exchange factor (GEF) 3
Domestic Rabbit(100352585) Rho guanine nucleotide exchange factor (GEF) 3
Zebrafish(570228) Rho guanine nucleotide exchange factor (GEF) 3
cow(782247) Rho guanine nucleotide exchange factor (GEF) 3
Horse(100051041) Rho guanine nucleotide exchange factor (GEF) 3
domestic cat(101096044) Rho guanine nucleotide exchange factor (GEF) 3
dog(476579) Rho guanine nucleotide exchange factor (GEF) 3
chicken(416000) Rho guanine nucleotide exchange factor (GEF) 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019555 Rosetta Predictions human pricing
NM_001106061 Rosetta Predictions rat pricing
NM_027871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164256 predicted 1737
2 SASI_Hs01_00164257 predicted 1415
3 SASI_Hs01_00164258 predicted 635
4 SASI_Hs01_00164259 predicted 328
5 SASI_Hs01_00164260 predicted 1404
6 SASI_Hs01_00164261 predicted 301
7 SASI_Hs01_00164262 predicted 895
8 SASI_Hs01_00164263 predicted 1043
9 SASI_Hs01_00164264 predicted 600
10 SASI_Hs01_00164265 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215242 predicted 274
2 SASI_Rn02_00215243 predicted 1723
3 SASI_Rn02_00215244 predicted 841
4 SASI_Rn02_00215245 predicted 1765
5 SASI_Rn02_00215246 predicted 1223
6 SASI_Rn02_00215247 predicted 866
7 SASI_Rn02_00215248 predicted 1737
8 SASI_Rn02_00215249 predicted 651
9 SASI_Rn02_00215250 predicted 263
10 SASI_Rn02_00215251 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161830 predicted 532
2 SASI_Mm01_00161831 predicted 242
3 SASI_Mm01_00161832 predicted 962
4 SASI_Mm01_00161833 predicted 1288
5 SASI_Mm01_00161834 predicted 725
6 SASI_Mm01_00161835 predicted 1722
7 SASI_Mm01_00161836 predicted 805
8 SASI_Mm01_00161837 predicted 1188
9 SASI_Mm01_00161839 predicted 1700
10 SASI_Mm02_00332831 predicted 866
11 SASI_Mm01_00161838 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019555
VALIDATED
ARHGEF3 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-967s21c1
Sequence:CCGGCCCTCTGCTTCTCCGAGAAATCTCGAGATTTCTCGGAGAAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-1088s21c1
Sequence:CCGGGAATCTGAATGCCGCTATTATCTCGAGATAATAGCGGCATTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019555.2-1948s21c1
Sequence:CCGGCTATTACCCTGTGTTGTATTTCTCGAGAAATACAACACAGGGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-503s1c1
Sequence:CCGGGCGATCTTTGAGCTTTCCCAACTCGAGTTGGGAAAGCTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-578s1c1
Sequence:CCGGCCCATGCTGAAACTCTCCATACTCGAGTATGGAGAGTTTCAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-1073s1c1
Sequence:CCGGCGGCTTCTTTACTTGGAAGAACTCGAGTTCTTCCAAGTAAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-226s1c1
Sequence:CCGGGCCTAGTAATAAACGGGTCAACTCGAGTTGACCCGTTTATTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-869s1c1
Sequence:CCGGCGCAAACTAGATCTCTGGAATCTCGAGATTCCAGAGATCTAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019555
VALIDATED
ARHGEF3 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-967s21c1
Sequence:CCGGCCCTCTGCTTCTCCGAGAAATCTCGAGATTTCTCGGAGAAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-1088s21c1
Sequence:CCGGGAATCTGAATGCCGCTATTATCTCGAGATAATAGCGGCATTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019555.2-1948s21c1
Sequence:CCGGCTATTACCCTGTGTTGTATTTCTCGAGAAATACAACACAGGGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-503s1c1
Sequence:CCGGGCGATCTTTGAGCTTTCCCAACTCGAGTTGGGAAAGCTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-578s1c1
Sequence:CCGGCCCATGCTGAAACTCTCCATACTCGAGTATGGAGAGTTTCAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-1073s1c1
Sequence:CCGGCGGCTTCTTTACTTGGAAGAACTCGAGTTCTTCCAAGTAAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-226s1c1
Sequence:CCGGGCCTAGTAATAAACGGGTCAACTCGAGTTGACCCGTTTATTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-869s1c1
Sequence:CCGGCGCAAACTAGATCTCTGGAATCTCGAGATTCCAGAGATCTAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019555
VALIDATED
ARHGEF3 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-967s21c1
Sequence:CCGGCCCTCTGCTTCTCCGAGAAATCTCGAGATTTCTCGGAGAAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019555.2-1088s21c1
Sequence:CCGGGAATCTGAATGCCGCTATTATCTCGAGATAATAGCGGCATTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019555.2-1948s21c1
Sequence:CCGGCTATTACCCTGTGTTGTATTTCTCGAGAAATACAACACAGGGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-503s1c1
Sequence:CCGGGCGATCTTTGAGCTTTCCCAACTCGAGTTGGGAAAGCTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-578s1c1
Sequence:CCGGCCCATGCTGAAACTCTCCATACTCGAGTATGGAGAGTTTCAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019555.1-1073s1c1
Sequence:CCGGCGGCTTCTTTACTTGGAAGAACTCGAGTTCTTCCAAGTAAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-226s1c1
Sequence:CCGGGCCTAGTAATAAACGGGTCAACTCGAGTTGACCCGTTTATTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019555.1-869s1c1
Sequence:CCGGCGCAAACTAGATCTCTGGAATCTCGAGATTCCAGAGATCTAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027871
VALIDATED
ARHGEF3 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-458s21c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-801s21c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027871.1-2841s21c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-964s21c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-2841s1c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-799s1c1
Sequence:CCGGGCGCTGTTTAGAATCACCCTTCTCGAGAAGGGTGATTCTAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-458s1c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-801s1c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-964s1c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027871
VALIDATED
ARHGEF3 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-458s21c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-801s21c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027871.1-2841s21c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-964s21c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-2841s1c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-799s1c1
Sequence:CCGGGCGCTGTTTAGAATCACCCTTCTCGAGAAGGGTGATTCTAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-458s1c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-801s1c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-964s1c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027871
VALIDATED
ARHGEF3 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-458s21c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-801s21c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027871.1-2841s21c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027871.1-964s21c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-2841s1c1
Sequence:CCGGCCAGTTTCATTAGCTCTCATTCTCGAGAATGAGAGCTAATGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-799s1c1
Sequence:CCGGGCGCTGTTTAGAATCACCCTTCTCGAGAAGGGTGATTCTAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-458s1c1
Sequence:CCGGGCGATCTTTGAACTTTCTCAACTCGAGTTGAGAAAGTTCAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-801s1c1
Sequence:CCGGGCTGTTTAGAATCACCCTTCACTCGAGTGAAGGGTGATTCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027871.1-964s1c1
Sequence:CCGGCCAGGGAATTGTGGCAGAAATCTCGAGATTTCTGCCACAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks