EMAIL THIS PAGE TO A FRIEND

ARHGEF40

Rho guanine nucleotide exchange factor (GEF) 40

147 Gene Product Result for
Synonyms: SOLO
UniProtKB ID: Q8TER5, A5PL07, Q9BWP5, Q9H7L6, Q9NTF9, Q9NW24
Gene ID:
Mouse(268739) Rho guanine nucleotide exchange factor (GEF) 40
Rat(361034) Rho guanine nucleotide exchange factor (GEF) 40
domestic guinea pig(100720080) Rho guanine nucleotide exchange factor (GEF) 40
naked mole-rat(101726117) Rho guanine nucleotide exchange factor (GEF) 40
sheep(101114961) Rho guanine nucleotide exchange factor (GEF) 40
dog(475398) Rho guanine nucleotide exchange factor (GEF) 40
cow(527362) Rho guanine nucleotide exchange factor (GEF) 40
domestic cat(101093191) Rho guanine nucleotide exchange factor (GEF) 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018071 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079391 MISSION® esiRNA esiRNA human AL161668.6-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018071 Rosetta Predictions human pricing
XM_001075554 Rosetta Predictions rat pricing
XM_341309 Rosetta Predictions rat pricing
NM_198249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179660 predicted 741
2 SASI_Hs01_00179661 predicted 506
3 SASI_Hs01_00179662 predicted 4195
4 SASI_Hs01_00179663 predicted 3956
5 SASI_Hs01_00179664 predicted 4516
6 SASI_Hs01_00179665 predicted 4596
7 SASI_Hs01_00179666 predicted 3857
8 SASI_Hs01_00179667 predicted 1592
9 SASI_Hs01_00179668 predicted 1878
10 SASI_Hs01_00179669 predicted 4596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350218 predicted 1706
2 SASI_Rn02_00350219 predicted 2219
3 SASI_Rn02_00350220 predicted 317
4 SASI_Rn02_00350221 predicted 4032
5 SASI_Rn02_00350222 predicted 2693
6 SASI_Rn02_00350223 predicted 3932
7 SASI_Rn02_00350224 predicted 566
8 SASI_Rn02_00350225 predicted 4099
9 SASI_Rn02_00350226 predicted 2000
10 SASI_Rn02_00350227 predicted 4217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392718 predicted 1936
2 SASI_Rn02_00392719 predicted 2454
3 SASI_Rn02_00392720 predicted 552
4 SASI_Rn02_00392721 predicted 4267
5 SASI_Rn02_00392722 predicted 2922
6 SASI_Rn02_00392723 predicted 4157
7 SASI_Rn02_00392724 predicted 792
8 SASI_Rn02_00392725 predicted 4329
9 SASI_Rn02_00392726 predicted 2227
10 SASI_Rn02_00392727 predicted 4452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026546 predicted 3999
2 SASI_Mm02_00350899 predicted 4006
3 SASI_Mm01_00026547 predicted 1426
4 SASI_Mm01_00026548 predicted 1679
5 SASI_Mm02_00350900 predicted 2040
6 SASI_Mm01_00026549 predicted 2420
7 SASI_Mm01_00026550 predicted 1393
8 SASI_Mm02_00350901 predicted 1976
9 SASI_Mm01_00026551 predicted 3959
10 SASI_Mm01_00026552 predicted 1551
11 SASI_Mm01_00026545 predicted 4298
12 SASI_Mm01_00026553 predicted 610
13 SASI_Mm01_00026554 predicted 4006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198249
ARHGEF40 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3943s1c1
Sequence:CCGGGCTCTTATTCAGCAAGCTCAACTCGAGTTGAGCTTGCTGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198249.1-4485s1c1
Sequence:CCGGGCCCTGTTCAATTGCCTTTATCTCGAGATAAAGGCAATTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3988s1c1
Sequence:CCGGCTTCGTTTACAAGCAGGCTTTCTCGAGAAAGCCTGCTTGTAAACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3313s1c1
Sequence:CCGGGCGTCTAGTGTCTGAACTGATCTCGAGATCAGTTCAGACACTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-650s1c1
Sequence:CCGGCCAAGTACATTGCCTCCAGAACTCGAGTTCTGGAGGCAATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198249
ARHGEF40 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3943s1c1
Sequence:CCGGGCTCTTATTCAGCAAGCTCAACTCGAGTTGAGCTTGCTGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198249.1-4485s1c1
Sequence:CCGGGCCCTGTTCAATTGCCTTTATCTCGAGATAAAGGCAATTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3988s1c1
Sequence:CCGGCTTCGTTTACAAGCAGGCTTTCTCGAGAAAGCCTGCTTGTAAACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3313s1c1
Sequence:CCGGGCGTCTAGTGTCTGAACTGATCTCGAGATCAGTTCAGACACTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-650s1c1
Sequence:CCGGCCAAGTACATTGCCTCCAGAACTCGAGTTCTGGAGGCAATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198249
ARHGEF40 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3943s1c1
Sequence:CCGGGCTCTTATTCAGCAAGCTCAACTCGAGTTGAGCTTGCTGAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198249.1-4485s1c1
Sequence:CCGGGCCCTGTTCAATTGCCTTTATCTCGAGATAAAGGCAATTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3988s1c1
Sequence:CCGGCTTCGTTTACAAGCAGGCTTTCTCGAGAAAGCCTGCTTGTAAACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-3313s1c1
Sequence:CCGGGCGTCTAGTGTCTGAACTGATCTCGAGATCAGTTCAGACACTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198249.1-650s1c1
Sequence:CCGGCCAAGTACATTGCCTCCAGAACTCGAGTTCTGGAGGCAATGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370737
VALIDATED
ARHGEF40 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 40
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000136388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1847s1c1
Sequence:CCGGCGCTGAACACAACTCTTCATTCTCGAGAATGAAGAGTTGTGTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370737.2-2041s1c1
Sequence:CCGGCCAACTGAACTCTGTGGATTTCTCGAGAAATCCACAGAGTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1848s1c1
Sequence:CCGGGCTGAACACAACTCTTCATTACTCGAGTAATGAAGAGTTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370737
VALIDATED
ARHGEF40 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 40
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000136388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1847s1c1
Sequence:CCGGCGCTGAACACAACTCTTCATTCTCGAGAATGAAGAGTTGTGTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370737.2-2041s1c1
Sequence:CCGGCCAACTGAACTCTGTGGATTTCTCGAGAAATCCACAGAGTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1848s1c1
Sequence:CCGGGCTGAACACAACTCTTCATTACTCGAGTAATGAAGAGTTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370737
VALIDATED
ARHGEF40 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 40
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000136388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1847s1c1
Sequence:CCGGCGCTGAACACAACTCTTCATTCTCGAGAATGAAGAGTTGTGTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370737.2-2041s1c1
Sequence:CCGGCCAACTGAACTCTGTGGATTTCTCGAGAAATCCACAGAGTTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_370737.2-1848s1c1
Sequence:CCGGGCTGAACACAACTCTTCATTACTCGAGTAATGAAGAGTTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018071
VALIDATED
ARHGEF40 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 40
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-4801s1c1
Sequence:CCGGGCCACATTGCTTGCCTTCATACTCGAGTATGAAGGCAAGCAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1958s1c1
Sequence:CCGGGCTGTCAGAGAATGATCTGAACTCGAGTTCAGATCATTCTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1725s1c1
Sequence:CCGGGACACGCTGAACACAACTCTTCTCGAGAAGAGTTGTGTTCAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-567s21c1
Sequence:CCGGGAGCTCATCTGTCCACGATTTCTCGAGAAATCGTGGACAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-1314s21c1
Sequence:CCGGCACCTGGTTAAGGAGGAATATCTCGAGATATTCCTCCTTAACCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3968s21c1
Sequence:CCGGTGTTTACAAGCAGGCCTTTAACTCGAGTTAAAGGCCTGCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-2581s21c1
Sequence:CCGGAGAAGGTGCTGGATATCTTTGCTCGAGCAAAGATATCCAGCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3652s21c1
Sequence:CCGGTGGAACAGCTGACTCGGTATGCTCGAGCATACCGAGTCAGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-4388s21c1
Sequence:CCGGGGATCTGGACGTCAAGCAAATCTCGAGATTTGCTTGACGTCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018071
VALIDATED
ARHGEF40 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 40
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-4801s1c1
Sequence:CCGGGCCACATTGCTTGCCTTCATACTCGAGTATGAAGGCAAGCAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1958s1c1
Sequence:CCGGGCTGTCAGAGAATGATCTGAACTCGAGTTCAGATCATTCTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1725s1c1
Sequence:CCGGGACACGCTGAACACAACTCTTCTCGAGAAGAGTTGTGTTCAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-567s21c1
Sequence:CCGGGAGCTCATCTGTCCACGATTTCTCGAGAAATCGTGGACAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-1314s21c1
Sequence:CCGGCACCTGGTTAAGGAGGAATATCTCGAGATATTCCTCCTTAACCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3968s21c1
Sequence:CCGGTGTTTACAAGCAGGCCTTTAACTCGAGTTAAAGGCCTGCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-2581s21c1
Sequence:CCGGAGAAGGTGCTGGATATCTTTGCTCGAGCAAAGATATCCAGCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3652s21c1
Sequence:CCGGTGGAACAGCTGACTCGGTATGCTCGAGCATACCGAGTCAGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-4388s21c1
Sequence:CCGGGGATCTGGACGTCAAGCAAATCTCGAGATTTGCTTGACGTCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018071
VALIDATED
ARHGEF40 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 40
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-4801s1c1
Sequence:CCGGGCCACATTGCTTGCCTTCATACTCGAGTATGAAGGCAAGCAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1958s1c1
Sequence:CCGGGCTGTCAGAGAATGATCTGAACTCGAGTTCAGATCATTCTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018071.3-1725s1c1
Sequence:CCGGGACACGCTGAACACAACTCTTCTCGAGAAGAGTTGTGTTCAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-567s21c1
Sequence:CCGGGAGCTCATCTGTCCACGATTTCTCGAGAAATCGTGGACAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-1314s21c1
Sequence:CCGGCACCTGGTTAAGGAGGAATATCTCGAGATATTCCTCCTTAACCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3968s21c1
Sequence:CCGGTGTTTACAAGCAGGCCTTTAACTCGAGTTAAAGGCCTGCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-2581s21c1
Sequence:CCGGAGAAGGTGCTGGATATCTTTGCTCGAGCAAAGATATCCAGCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-3652s21c1
Sequence:CCGGTGGAACAGCTGACTCGGTATGCTCGAGCATACCGAGTCAGCTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018071.3-4388s21c1
Sequence:CCGGGGATCTGGACGTCAAGCAAATCTCGAGATTTGCTTGACGTCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks