EMAIL THIS PAGE TO A FRIEND

ARHGEF4

Rho guanine nucleotide exchange factor (GEF) 4

85 Gene Product Result for
Synonyms: ASEF ASEF1 GEF4 STM6
UniProtKB ID: Q9NR80, Q9HDC6, Q9UPP0
Gene ID:
Human(50649) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
Mouse(226970) Rho guanine nucleotide exchange factor (GEF) 4
Rat(301334) Rho guanine nucleotide exchange factor (GEF) 4
Zebrafish(559017) Rho guanine nucleotide exchange factor (GEF) 4
cow(505852) Rho guanine nucleotide exchange factor (GEF) 4
Horse(100067370) Rho guanine nucleotide exchange factor (GEF) 4
domestic cat(101089634) Rho guanine nucleotide exchange factor (GEF) 4
dog(483856) Rho guanine nucleotide exchange factor (GEF) 4
chicken(424761) Rho guanine nucleotide exchange factor (GEF) 4
sheep(101104720) Rho guanine nucleotide exchange factor (GEF) 4
naked mole-rat(101713627) Rho guanine nucleotide exchange factor (GEF) 4
domestic guinea pig(100728096) Rho guanine nucleotide exchange factor (GEF) 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015320 Rosetta Predictions human pricing
NM_032995 Rosetta Predictions human pricing
XM_001055650 Rosetta Predictions rat pricing
XM_237049 Rosetta Predictions rat pricing
NM_183019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186897 predicted 1929
2 SASI_Hs02_00347590 predicted 1517
3 SASI_Hs01_00186898 predicted 767
4 SASI_Hs01_00186899 predicted 829
5 SASI_Hs01_00186900 predicted 560
6 SASI_Hs01_00186901 predicted 2044
7 SASI_Hs01_00186902 predicted 2737
8 SASI_Hs01_00186903 predicted 833
9 SASI_Hs01_00186904 predicted 2734
10 SASI_Hs01_00186905 predicted 1468
11 SASI_Hs01_00186906 predicted 2078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128127 predicted 1928
2 SASI_Hs01_00128128 predicted 1489
3 SASI_Hs01_00128129 predicted 767
4 SASI_Hs01_00128130 predicted 564
5 SASI_Hs01_00128131 predicted 2037
6 SASI_Hs01_00128132 predicted 1530
7 SASI_Hs01_00128133 predicted 1472
8 SASI_Hs01_00128136 predicted 2202
9 SASI_Hs02_00360634 predicted 1851
10 SASI_Hs02_00360635 predicted 1096
11 SASI_Hs01_00128134 predicted 1649
12 SASI_Hs01_00128135 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280459 predicted 2751
2 SASI_Rn02_00280460 predicted 3311
3 SASI_Rn02_00280461 predicted 2749
4 SASI_Rn02_00280462 predicted 264
5 SASI_Rn02_00280463 predicted 344
6 SASI_Rn02_00280464 predicted 686
7 SASI_Rn02_00280465 predicted 2600
8 SASI_Rn02_00280466 predicted 611
9 SASI_Rn02_00280467 predicted 239
10 SASI_Rn02_00280468 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390610 predicted 1556
2 SASI_Rn02_00390611 predicted 270
3 SASI_Rn02_00390612 predicted 343
4 SASI_Rn02_00390613 predicted 687
5 SASI_Rn02_00390614 predicted 609
6 SASI_Rn02_00390615 predicted 237
7 SASI_Rn02_00390616 predicted 468
8 SASI_Rn02_00390617 predicted 1408
9 SASI_Rn02_00390618 predicted 1850
10 SASI_Rn02_00390619 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145796 predicted 1737
2 SASI_Mm01_00145797 predicted 902
3 SASI_Mm01_00145798 predicted 1792
4 SASI_Mm01_00145799 predicted 1967
5 SASI_Mm01_00145800 predicted 564
6 SASI_Mm01_00145801 predicted 1643
7 SASI_Mm01_00145802 predicted 574
8 SASI_Mm01_00145803 predicted 444
9 SASI_Mm01_00145804 predicted 601
10 SASI_Mm01_00145805 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015320
ARHGEF4 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1932s21c1
Sequence:CCGGGACTTGAGAACATCGACAAGACTCGAGTCTTGTCGATGTTCTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1498s21c1
Sequence:CCGGGCGTACCATCTTCGGGAACATCTCGAGATGTTCCCGAAGATGGTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1375s21c1
Sequence:CCGGGACCAACGTCATCAACGAGATCTCGAGATCTCGTTGATGACGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-2132s21c1
Sequence:CCAGCGCGACGTGTTGTACTACAAGCTCGAGCTTGTAGTACAACACGTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2071s1c1
Sequence:CCGGGCAGCGAATGTTCTTTCTCTTCTCGAGAAGAGAAAGAACATTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-1702s1c1
Sequence:CCGGGCTCAGCAAGTACGTGTACTTCTCGAGAAGTACACGTACTTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2212s1c1
Sequence:CCGGCCTCCATGTGAGCATCAAGAACTCGAGTTCTTGATGCTCACATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2098s1c1
Sequence:CCGGCCAGCTCATCTACTGTAAGAACTCGAGTTCTTACAGTAGATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-820s1c1
Sequence:CCGGGTGCTGGAGAAAGACGATCATCTCGAGATGATCGTCTTTCTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015320
ARHGEF4 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1932s21c1
Sequence:CCGGGACTTGAGAACATCGACAAGACTCGAGTCTTGTCGATGTTCTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1498s21c1
Sequence:CCGGGCGTACCATCTTCGGGAACATCTCGAGATGTTCCCGAAGATGGTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1375s21c1
Sequence:CCGGGACCAACGTCATCAACGAGATCTCGAGATCTCGTTGATGACGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-2132s21c1
Sequence:CCAGCGCGACGTGTTGTACTACAAGCTCGAGCTTGTAGTACAACACGTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2071s1c1
Sequence:CCGGGCAGCGAATGTTCTTTCTCTTCTCGAGAAGAGAAAGAACATTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-1702s1c1
Sequence:CCGGGCTCAGCAAGTACGTGTACTTCTCGAGAAGTACACGTACTTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2212s1c1
Sequence:CCGGCCTCCATGTGAGCATCAAGAACTCGAGTTCTTGATGCTCACATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2098s1c1
Sequence:CCGGCCAGCTCATCTACTGTAAGAACTCGAGTTCTTACAGTAGATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-820s1c1
Sequence:CCGGGTGCTGGAGAAAGACGATCATCTCGAGATGATCGTCTTTCTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015320
ARHGEF4 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1932s21c1
Sequence:CCGGGACTTGAGAACATCGACAAGACTCGAGTCTTGTCGATGTTCTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1498s21c1
Sequence:CCGGGCGTACCATCTTCGGGAACATCTCGAGATGTTCCCGAAGATGGTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-1375s21c1
Sequence:CCGGGACCAACGTCATCAACGAGATCTCGAGATCTCGTTGATGACGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015320.2-2132s21c1
Sequence:CCAGCGCGACGTGTTGTACTACAAGCTCGAGCTTGTAGTACAACACGTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2071s1c1
Sequence:CCGGGCAGCGAATGTTCTTTCTCTTCTCGAGAAGAGAAAGAACATTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-1702s1c1
Sequence:CCGGGCTCAGCAAGTACGTGTACTTCTCGAGAAGTACACGTACTTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2212s1c1
Sequence:CCGGCCTCCATGTGAGCATCAAGAACTCGAGTTCTTGATGCTCACATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-2098s1c1
Sequence:CCGGCCAGCTCATCTACTGTAAGAACTCGAGTTCTTACAGTAGATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015320.2-820s1c1
Sequence:CCGGGTGCTGGAGAAAGACGATCATCTCGAGATGATCGTCTTTCTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183019
ARHGEF4 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183019.2-2070s1c1
Sequence:CCGGGCTCTGGACATTCTTTGGAAACTCGAGTTTCCAAAGAATGTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-665s1c1
Sequence:CCGGCGGGAGGATATGTTCAGTGAACTCGAGTTCACTGAACATATCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1103s1c1
Sequence:CCGGCAGCTCATCAACGAACGGAAACTCGAGTTTCCGTTCGTTGATGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-937s1c1
Sequence:CCGGGCTGCAAAGGATGATTGACATCTCGAGATGTCAATCATCCTTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1292s1c1
Sequence:CCGGCGCCAGCTCATCTACTGTAAACTCGAGTTTACAGTAGATGAGCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183019
ARHGEF4 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183019.2-2070s1c1
Sequence:CCGGGCTCTGGACATTCTTTGGAAACTCGAGTTTCCAAAGAATGTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-665s1c1
Sequence:CCGGCGGGAGGATATGTTCAGTGAACTCGAGTTCACTGAACATATCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1103s1c1
Sequence:CCGGCAGCTCATCAACGAACGGAAACTCGAGTTTCCGTTCGTTGATGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-937s1c1
Sequence:CCGGGCTGCAAAGGATGATTGACATCTCGAGATGTCAATCATCCTTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1292s1c1
Sequence:CCGGCGCCAGCTCATCTACTGTAAACTCGAGTTTACAGTAGATGAGCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183019
ARHGEF4 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183019.2-2070s1c1
Sequence:CCGGGCTCTGGACATTCTTTGGAAACTCGAGTTTCCAAAGAATGTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-665s1c1
Sequence:CCGGCGGGAGGATATGTTCAGTGAACTCGAGTTCACTGAACATATCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1103s1c1
Sequence:CCGGCAGCTCATCAACGAACGGAAACTCGAGTTTCCGTTCGTTGATGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-937s1c1
Sequence:CCGGGCTGCAAAGGATGATTGACATCTCGAGATGTCAATCATCCTTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183019.2-1292s1c1
Sequence:CCGGCGCCAGCTCATCTACTGTAAACTCGAGTTTACAGTAGATGAGCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)