EMAIL THIS PAGE TO A FRIEND

ARHGEF5

Rho guanine nucleotide exchange factor (GEF) 5

122 Gene Product Result for
Synonyms: GEF5 P60 TIM TIM1
UniProtKB ID: Q12774, A6NNJ2, Q6ZML7
Gene ID:
Human(7984) Summary: Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
Mouse(54324) Rho guanine nucleotide exchange factor (GEF) 5
Rat(140898) Rho guanine nucleotide exchange factor (GEF) 5
cow(516290) Rho guanine nucleotide exchange factor (GEF) 5
domestic cat(101085537) Rho guanine nucleotide exchange factor (GEF) 5
dog(482718) Rho guanine nucleotide exchange factor (GEF) 5
sheep(101105817) Rho guanine nucleotide exchange factor (GEF) 5
Domestic Rabbit(100356288) Rho guanine nucleotide exchange factor (GEF) 5
naked mole-rat(101706564) Rho guanine nucleotide exchange factor (GEF) 5
domestic guinea pig(100723392) Rho guanine nucleotide exchange factor (GEF) 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005435 Rosetta Predictions human pricing
XM_001073085 Rosetta Predictions rat pricing
XM_342676 Rosetta Predictions rat pricing
NM_133674 Rosetta Predictions mouse pricing
XM_979233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218822 predicted 889
2 SASI_Hs01_00218823 predicted 3851
3 SASI_Hs01_00218824 predicted 3392
4 SASI_Hs01_00218825 predicted 2131
5 SASI_Hs01_00218826 predicted 2593
6 SASI_Hs01_00218827 predicted 627
7 SASI_Hs01_00218829 predicted 286
8 SASI_Hs01_00218830 predicted 3699
9 SASI_Hs01_00218831 predicted 579
10 SASI_Hs02_00339588 predicted 1755
11 SASI_Hs01_00218828 predicted 4694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341474 predicted 2275
2 SASI_Rn02_00341475 predicted 4982
3 SASI_Rn02_00341476 predicted 1156
4 SASI_Rn02_00341477 predicted 2306
5 SASI_Rn02_00341478 predicted 4036
6 SASI_Rn02_00341479 predicted 4509
7 SASI_Rn02_00341480 predicted 3290
8 SASI_Rn02_00341481 predicted 712
9 SASI_Rn02_00341482 predicted 5024
10 SASI_Rn02_00341483 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394651 predicted 2277
2 SASI_Rn02_00394652 predicted 2507
3 SASI_Rn02_00394653 predicted 3534
4 SASI_Rn02_00394654 predicted 1158
5 SASI_Rn02_00394655 predicted 2304
6 SASI_Rn02_00394656 predicted 3291
7 SASI_Rn02_00394657 predicted 709
8 SASI_Rn02_00394658 predicted 1925
9 SASI_Rn02_00394659 predicted 1719
10 SASI_Rn02_00394660 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338623 predicted 560
2 SASI_Mm02_00338624 predicted 1852
3 SASI_Mm02_00338625 predicted 1403
4 SASI_Mm02_00338626 predicted 3593
5 SASI_Mm02_00338627 predicted 3617
6 SASI_Mm02_00338628 predicted 3178
7 SASI_Mm02_00338629 predicted 985
8 SASI_Mm02_00338630 predicted 2317
9 SASI_Mm02_00338631 predicted 2368
10 SASI_Mm02_00338632 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257777 predicted 1003
2 SASI_Mm01_00257778 predicted 1840
3 SASI_Mm01_00257779 predicted 4031
4 SASI_Mm01_00257780 predicted 4068
5 SASI_Mm01_00257781 predicted 3627
6 SASI_Mm01_00257782 predicted 1437
7 SASI_Mm01_00257783 predicted 863
8 SASI_Mm01_00257784 predicted 2198
9 SASI_Mm01_00257785 predicted 2807
10 SASI_Mm01_00257786 predicted 1813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133674
VALIDATED
ARHGEF5 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-239s21c1
Sequence:CCGGGACCGAGACCCATCCTATAAGCTCGAGCTTATAGGATGGGTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-5185s21c1
Sequence:CCGGTTGTGGACAGACCTATGTTACCTCGAGGTAACATAGGTCTGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2698s21c1
Sequence:CCGGAGCCAAGCCAAGACCTAATAACTCGAGTTATTAGGTCTTGGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2663s21c1
Sequence:CCGGAGTATCCAGGGAGGAGTTATACTCGAGTATAACTCCTCCCTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-313s21c1
Sequence:CCGGGGGTGACCATACACCTAATAGCTCGAGCTATTAGGTGTATGGTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133674
VALIDATED
ARHGEF5 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-239s21c1
Sequence:CCGGGACCGAGACCCATCCTATAAGCTCGAGCTTATAGGATGGGTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-5185s21c1
Sequence:CCGGTTGTGGACAGACCTATGTTACCTCGAGGTAACATAGGTCTGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2698s21c1
Sequence:CCGGAGCCAAGCCAAGACCTAATAACTCGAGTTATTAGGTCTTGGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2663s21c1
Sequence:CCGGAGTATCCAGGGAGGAGTTATACTCGAGTATAACTCCTCCCTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-313s21c1
Sequence:CCGGGGGTGACCATACACCTAATAGCTCGAGCTATTAGGTGTATGGTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133674
VALIDATED
ARHGEF5 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-239s21c1
Sequence:CCGGGACCGAGACCCATCCTATAAGCTCGAGCTTATAGGATGGGTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-5185s21c1
Sequence:CCGGTTGTGGACAGACCTATGTTACCTCGAGGTAACATAGGTCTGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2698s21c1
Sequence:CCGGAGCCAAGCCAAGACCTAATAACTCGAGTTATTAGGTCTTGGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-2663s21c1
Sequence:CCGGAGTATCCAGGGAGGAGTTATACTCGAGTATAACTCCTCCCTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133674.1-313s21c1
Sequence:CCGGGGGTGACCATACACCTAATAGCTCGAGCTATTAGGTGTATGGTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002861
ARHGEF5 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002861.1-4054s1c1
Sequence:CCGGGCAATAACAATGTCCAGAGTACTCGAGTACTCTGGACATTGTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2895s1c1
Sequence:CCGGGCAACATGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-1541s1c1
Sequence:CCGGCCTGACAAGGAAATAGATCAACTCGAGTTGATCTATTTCCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2134s1c1
Sequence:CCGGCTCTCAAGAATCCATCTCAAACTCGAGTTTGAGATGGATTCTTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-689s1c1
Sequence:CCGGGCAGAGACCAACCAGAATGAACTCGAGTTCATTCTGGTTGGTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002861
ARHGEF5 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002861.1-4054s1c1
Sequence:CCGGGCAATAACAATGTCCAGAGTACTCGAGTACTCTGGACATTGTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2895s1c1
Sequence:CCGGGCAACATGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-1541s1c1
Sequence:CCGGCCTGACAAGGAAATAGATCAACTCGAGTTGATCTATTTCCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2134s1c1
Sequence:CCGGCTCTCAAGAATCCATCTCAAACTCGAGTTTGAGATGGATTCTTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-689s1c1
Sequence:CCGGGCAGAGACCAACCAGAATGAACTCGAGTTCATTCTGGTTGGTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002861
ARHGEF5 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002861.1-4054s1c1
Sequence:CCGGGCAATAACAATGTCCAGAGTACTCGAGTACTCTGGACATTGTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2895s1c1
Sequence:CCGGGCAACATGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-1541s1c1
Sequence:CCGGCCTGACAAGGAAATAGATCAACTCGAGTTGATCTATTTCCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-2134s1c1
Sequence:CCGGCTCTCAAGAATCCATCTCAAACTCGAGTTTGAGATGGATTCTTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002861.1-689s1c1
Sequence:CCGGGCAGAGACCAACCAGAATGAACTCGAGTTCATTCTGGTTGGTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks