EMAIL THIS PAGE TO A FRIEND

ARHGEF6

Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6

147 Gene Product Result for
Synonyms: COOL2 Cool-2 MRX46 PIXA alpha-PIX alphaPIX
Gene ID:
Human(9459) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It may form a complex with G proteins and stimulate Rho-dependent signals. This protein is activated by PI3-kinase. Mutations in this gene can cause X-chromosomal non-specific mental retardation. [provided by RefSeq, Jul 2008]
Mouse(73341) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Rat(363509) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
domestic guinea pig(100719019) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
naked mole-rat(101700245) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
sheep(101104043) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Domestic Rabbit(100358647) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
chicken(422247) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
cow(533823) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Horse(100056622) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
domestic cat(101099030) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
dog(610290) Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004840 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004840 Rosetta Predictions human pricing
NM_001005565 Rosetta Predictions rat pricing
XM_579144 Rosetta Predictions rat pricing
NM_152801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065756 predicted 2227
2 SASI_Hs01_00065759 predicted 1397
3 SASI_Hs02_00338418 predicted 2025
4 SASI_Hs02_00338419 predicted 1166
5 SASI_Hs01_00065760 predicted 928
6 SASI_Hs02_00338420 predicted 835
7 SASI_Hs01_00065761 predicted 1630
8 SASI_Hs01_00065762 predicted 1611
9 SASI_Hs01_00065763 predicted 1194
10 SASI_Hs02_00338421 predicted 2380
11 SASI_Hs01_00065755 predicted 2005
12 SASI_Hs01_00065757 predicted 2035
13 SASI_Hs01_00065758 predicted 663
14 SASI_Hs01_00065764 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062675 predicted 1564
2 SASI_Rn01_00062676 predicted 1174
3 SASI_Rn01_00062677 predicted 1139
4 SASI_Rn01_00062678 predicted 1456
5 SASI_Rn02_00198430 predicted 840
6 SASI_Rn01_00062679 predicted 705
7 SASI_Rn01_00062680 predicted 900
8 SASI_Rn01_00062681 predicted 1033
9 SASI_Rn01_00062682 predicted 1195
10 SASI_Rn01_00062683 predicted 1154
11 SASI_Rn01_00062684 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177375 predicted 1570
2 SASI_Rn01_00177376 predicted 1172
3 SASI_Rn01_00177377 predicted 1150
4 SASI_Rn01_00177378 predicted 1463
5 SASI_Rn01_00177379 predicted 710
6 SASI_Rn01_00177380 predicted 913
7 SASI_Rn01_00177381 predicted 1044
8 SASI_Rn01_00177382 predicted 1194
9 SASI_Rn01_00177383 predicted 1163
10 SASI_Rn01_00177384 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098818 predicted 1795
2 SASI_Mm02_00342799 predicted 2187
3 SASI_Mm01_00098819 predicted 1360
4 SASI_Mm01_00098820 predicted 248
5 SASI_Mm01_00098821 predicted 2339
6 SASI_Mm01_00098822 predicted 777
7 SASI_Mm01_00098823 predicted 920
8 SASI_Mm02_00342800 predicted 2361
9 SASI_Mm02_00342801 predicted 1491
10 SASI_Mm01_00098824 predicted 696
11 SASI_Mm01_00098825 predicted 506
12 SASI_Mm01_00098826 predicted 1988
13 SASI_Mm01_00098827 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004840
VALIDATED
ARHGEF6 MISSION shRNA Bacterial Glycerol Stock
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2413s1c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1790s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-657s1c1
Sequence:CCGGCCAGTAATTATGTCCGTGAAACTCGAGTTTCACGGACATAATTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1710s1c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2241s1c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2224s21c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2675s21c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004840.2-2847s21c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2144s21c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004840
VALIDATED
ARHGEF6 MISSION shRNA shRNA Plasmid DNA
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2413s1c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1790s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-657s1c1
Sequence:CCGGCCAGTAATTATGTCCGTGAAACTCGAGTTTCACGGACATAATTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1710s1c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2241s1c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2224s21c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2675s21c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004840.2-2847s21c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2144s21c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004840
VALIDATED
ARHGEF6 MISSION shRNA Lentiviral Transduction Particles
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2413s1c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1790s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-657s1c1
Sequence:CCGGCCAGTAATTATGTCCGTGAAACTCGAGTTTCACGGACATAATTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-1710s1c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004840.1-2241s1c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2224s21c1
Sequence:CCGGCCGTGGAGTTTAAGTTGTCTACTCGAGTAGACAACTTAAACTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2675s21c1
Sequence:CCGGGCCTGGAAGAAGAACTGAAATCTCGAGATTTCAGTTCTTCTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004840.2-2847s21c1
Sequence:CCGGGCTGAATGATTTGACTCAGTTCTCGAGAACTGAGTCAAATCATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004840.2-2144s21c1
Sequence:CCGGCGTCATCATGTAGTGCTCATTCTCGAGAATGAGCACTACATGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152801
ARHGEF6 MISSION shRNA Bacterial Glycerol Stock
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-900s1c1
Sequence:CCGGCCTAAGGCTATCAAAGGATTTCTCGAGAAATCCTTTGATAGCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152801.1-2690s1c1
Sequence:CCGGCCACTGTTTGATTCAGAGTTTCTCGAGAAACTCTGAATCAAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-1986s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGCCTACTCGAGTAGGCAACTTAAACTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-899s1c1
Sequence:CCGGCCCTAAGGCTATCAAAGGATTCTCGAGAATCCTTTGATAGCCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-2143s1c1
Sequence:CCGGCCGAGGAAGAATACGTGATTACTCGAGTAATCACGTATTCTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152801
ARHGEF6 MISSION shRNA shRNA Plasmid DNA
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-900s1c1
Sequence:CCGGCCTAAGGCTATCAAAGGATTTCTCGAGAAATCCTTTGATAGCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152801.1-2690s1c1
Sequence:CCGGCCACTGTTTGATTCAGAGTTTCTCGAGAAACTCTGAATCAAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-1986s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGCCTACTCGAGTAGGCAACTTAAACTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-899s1c1
Sequence:CCGGCCCTAAGGCTATCAAAGGATTCTCGAGAATCCTTTGATAGCCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-2143s1c1
Sequence:CCGGCCGAGGAAGAATACGTGATTACTCGAGTAATCACGTATTCTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152801
ARHGEF6 MISSION shRNA Lentiviral Transduction Particles
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-900s1c1
Sequence:CCGGCCTAAGGCTATCAAAGGATTTCTCGAGAAATCCTTTGATAGCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152801.1-2690s1c1
Sequence:CCGGCCACTGTTTGATTCAGAGTTTCTCGAGAAACTCTGAATCAAACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-1986s1c1
Sequence:CCGGCCGTGGAGTTTAAGTTGCCTACTCGAGTAGGCAACTTAAACTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-899s1c1
Sequence:CCGGCCCTAAGGCTATCAAAGGATTCTCGAGAATCCTTTGATAGCCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152801.1-2143s1c1
Sequence:CCGGCCGAGGAAGAATACGTGATTACTCGAGTAATCACGTATTCTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)