EMAIL THIS PAGE TO A FRIEND

ARHGEF7

Rho guanine nucleotide exchange factor (GEF) 7

Synonyms: BETA-PIX COOL-1 COOL1 Nbla10314 P50 P50BP P85 P85COOL1 P85SPR PAK3 PIXB
Gene ID:
Human(8874) Summary: Rho GTPases play a fundamental role in numerous cellular processes triggered by extracellular stimuli that work through G protein coupled receptors. The encoded protein belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. This protein can induce membrane ruffling. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(54126) Rho guanine nucleotide exchange factor (GEF7)
Rat(114559) Rho guanine nucleotide exchange factor (GEF) 7
chicken(418761) Rho guanine nucleotide exchange factor (GEF) 7
cow(524352) Rho guanine nucleotide exchange factor (GEF) 7
Horse(100066489) Rho guanine nucleotide exchange factor (GEF) 7
domestic cat(101090075) Rho guanine nucleotide exchange factor (GEF) 7
dog(485552) Rho guanine nucleotide exchange factor (GEF) 7
sheep(101116845) Rho guanine nucleotide exchange factor (GEF) 7
naked mole-rat(101713994) Rho guanine nucleotide exchange factor (GEF) 7
domestic guinea pig(100717780) Rho guanine nucleotide exchange factor (GEF) 7
235 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003899 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113511 Rosetta Predictions human pricing
NM_001113512 Rosetta Predictions human pricing
NM_001113513 Rosetta Predictions human pricing
NM_003899 Rosetta Predictions human pricing
NM_145735 Rosetta Predictions human pricing
NM_001113521 Rosetta Predictions rat pricing
NM_001113522 Rosetta Predictions rat pricing
NM_053740 Rosetta Predictions rat pricing
NM_001113517 Rosetta Predictions mouse pricing
NM_001113518 Rosetta Predictions mouse pricing
NM_017402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325961 predicted 1019
2 SASI_Hs02_00325962 predicted 1699
3 SASI_Hs02_00325963 predicted 1520
4 SASI_Hs02_00325964 predicted 1912
5 SASI_Hs02_00325965 predicted 2015
6 SASI_Hs02_00325966 predicted 771
7 SASI_Hs02_00325967 predicted 2002
8 SASI_Hs02_00325968 predicted 1835
9 SASI_Hs02_00325969 predicted 1055
10 SASI_Hs02_00325970 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325971 predicted 869
2 SASI_Hs02_00325972 predicted 1554
3 SASI_Hs02_00325973 predicted 1367
4 SASI_Hs02_00325974 predicted 1761
5 SASI_Hs02_00325975 predicted 1861
6 SASI_Hs02_00325976 predicted 614
7 SASI_Hs02_00325977 predicted 1847
8 SASI_Hs02_00325978 predicted 1693
9 SASI_Hs02_00325979 predicted 904
10 SASI_Hs02_00325980 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325981 predicted 619
2 SASI_Hs02_00325982 predicted 1303
3 SASI_Hs02_00325983 predicted 1122
4 SASI_Hs02_00325984 predicted 1504
5 SASI_Hs02_00325985 predicted 1612
6 SASI_Hs02_00325986 predicted 1604
7 SASI_Hs02_00325987 predicted 1440
8 SASI_Hs02_00325988 predicted 656
9 SASI_Hs02_00325989 predicted 660
10 SASI_Hs02_00325990 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205605 predicted 739
2 SASI_Hs01_00205606 predicted 1412
3 SASI_Hs01_00205607 predicted 1232
4 SASI_Hs01_00205608 predicted 1625
5 SASI_Hs01_00205609 predicted 1730
6 SASI_Hs01_00205610 predicted 1708
7 SASI_Hs01_00205611 predicted 1552
8 SASI_Hs01_00205612 predicted 762
9 SASI_Hs01_00205613 predicted 778
10 SASI_Hs01_00205614 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217213 predicted 956
2 SASI_Hs01_00217214 predicted 1644
3 SASI_Hs01_00217215 predicted 1461
4 SASI_Hs01_00217216 predicted 1848
5 SASI_Hs01_00217217 predicted 1946
6 SASI_Hs01_00217218 predicted 709
7 SASI_Hs01_00217219 predicted 1941
8 SASI_Hs01_00217221 predicted 1779
9 SASI_Hs01_00217222 predicted 995
10 SASI_Hs02_00365331 predicted 1000
11 SASI_Hs01_00217220 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251853 predicted 1448
2 SASI_Rn02_00251854 predicted 1382
3 SASI_Rn02_00251855 predicted 590
4 SASI_Rn02_00251856 predicted 743
5 SASI_Rn02_00251857 predicted 662
6 SASI_Rn02_00251858 predicted 764
7 SASI_Rn02_00251859 predicted 1244
8 SASI_Rn02_00251860 predicted 1110
9 SASI_Rn02_00251861 predicted 1158
10 SASI_Rn02_00251862 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251863 predicted 1452
2 SASI_Rn02_00251864 predicted 1384
3 SASI_Rn02_00251865 predicted 590
4 SASI_Rn02_00251866 predicted 739
5 SASI_Rn02_00251867 predicted 664
6 SASI_Rn02_00251868 predicted 757
7 SASI_Rn02_00251869 predicted 1241
8 SASI_Rn02_00251870 predicted 1117
9 SASI_Rn02_00251871 predicted 1158
10 SASI_Rn02_00251872 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049686 predicted 1082
2 SASI_Rn02_00266522 predicted 1015
3 SASI_Rn02_00266523 predicted 222
4 SASI_Rn02_00266524 predicted 375
5 SASI_Rn01_00049688 predicted 304
6 SASI_Rn02_00266525 predicted 398
7 SASI_Rn01_00049689 predicted 876
8 SASI_Rn01_00049690 predicted 753
9 SASI_Rn01_00049691 predicted 787
10 SASI_Rn01_00049693 predicted 261
11 SASI_Rn01_00049687 predicted 1660
12 SASI_Rn01_00049692 predicted 904
13 SASI_Rn01_00049694 predicted 1609
14 SASI_Rn01_00049695 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308043 predicted 836
2 SASI_Mm02_00308044 predicted 892
3 SASI_Mm02_00308045 predicted 1663
4 SASI_Mm02_00308046 predicted 1699
5 SASI_Mm02_00308047 predicted 600
6 SASI_Mm02_00308048 predicted 642
7 SASI_Mm02_00308049 predicted 1684
8 SASI_Mm02_00308050 predicted 922
9 SASI_Mm02_00308051 predicted 1014
10 SASI_Mm02_00308052 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308053 predicted 1086
2 SASI_Mm02_00308054 predicted 627
3 SASI_Mm02_00308055 predicted 674
4 SASI_Mm02_00308056 predicted 1453
5 SASI_Mm02_00308057 predicted 1493
6 SASI_Mm02_00308058 predicted 434
7 SASI_Mm02_00308059 predicted 1471
8 SASI_Mm02_00308060 predicted 710
9 SASI_Mm02_00308061 predicted 801
10 SASI_Mm02_00308062 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323908 predicted 1080
2 SASI_Mm02_00323909 predicted 624
3 SASI_Mm01_00083325 predicted 675
4 SASI_Mm01_00083326 predicted 1454
5 SASI_Mm01_00083328 predicted 1489
6 SASI_Mm01_00083329 predicted 431
7 SASI_Mm01_00083330 predicted 1472
8 SASI_Mm01_00083331 predicted 707
9 SASI_Mm01_00083332 predicted 805
10 SASI_Mm01_00083333 predicted 613
11 SASI_Mm01_00083327 predicted 2410
12 SASI_Mm01_00083334 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017402
VALIDATED
ARHGEF7 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1178s21c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2007s21c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-3161s21c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1135s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2181s21c1
Sequence:CCGGGATACGGTGTATGCGTTAAAGCTCGAGCTTTAACGCATACACCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1992s1c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-3146s1c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1997s1c1
Sequence:CCGGCCTGAAGGTTATCGAAGCTTACTCGAGTAAGCTTCGATAACCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017402.2-628s1c1
Sequence:CCGGGCCCTCCCAAAGGGTTCGATACTCGAGTATCGAACCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1163s1c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017402
VALIDATED
ARHGEF7 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1178s21c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2007s21c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-3161s21c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1135s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2181s21c1
Sequence:CCGGGATACGGTGTATGCGTTAAAGCTCGAGCTTTAACGCATACACCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1992s1c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-3146s1c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1997s1c1
Sequence:CCGGCCTGAAGGTTATCGAAGCTTACTCGAGTAAGCTTCGATAACCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017402.2-628s1c1
Sequence:CCGGGCCCTCCCAAAGGGTTCGATACTCGAGTATCGAACCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1163s1c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017402
VALIDATED
ARHGEF7 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1178s21c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2007s21c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-3161s21c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-1135s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017402.4-2181s21c1
Sequence:CCGGGATACGGTGTATGCGTTAAAGCTCGAGCTTTAACGCATACACCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1992s1c1
Sequence:CCGGCAGATCCTGAAGGTTATCGAACTCGAGTTCGATAACCTTCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-3146s1c1
Sequence:CCGGGCGAGAATAAAGCAATACAAACTCGAGTTTGTATTGCTTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1997s1c1
Sequence:CCGGCCTGAAGGTTATCGAAGCTTACTCGAGTAAGCTTCGATAACCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017402.2-628s1c1
Sequence:CCGGGCCCTCCCAAAGGGTTCGATACTCGAGTATCGAACCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017402.2-1163s1c1
Sequence:CCGGGAAGTCTATGACGGCCTTCAACTCGAGTTGAAGGCCGTCATAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003899
VALIDATED
ARHGEF7 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-878s21c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003899.3-1366s21c1
Sequence:CCGGACTGGGAGGGCGATGACATTACTCGAGTAATGTCATCGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-2261s21c1
Sequence:CCGGGAGTCTTGTGGATACCGTATACTCGAGTATACGGTATCCACAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-1225s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003899.3-2587s21c1
Sequence:CCGGTGCGAATGGAGACGATCAAACCTCGAGGTTTGATCGTCTCCATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-709s1c1
Sequence:CCGGGCCCTCCCAAAGGATTTGATACTCGAGTATCAAATCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-2392s1c1
Sequence:CCGGCCTGGGATGAGACCAATCTATCTCGAGATAGATTGGTCTCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1938s1c1
Sequence:CCGGCTCTGCTACAAGGAGGATCTTCTCGAGAAGATCCTCCTTGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-854s1c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1601s1c1
Sequence:CCGGGCGGATATTAGTGTCGTGCAACTCGAGTTGCACGACACTAATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003899
VALIDATED
ARHGEF7 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-878s21c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003899.3-1366s21c1
Sequence:CCGGACTGGGAGGGCGATGACATTACTCGAGTAATGTCATCGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-2261s21c1
Sequence:CCGGGAGTCTTGTGGATACCGTATACTCGAGTATACGGTATCCACAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-1225s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003899.3-2587s21c1
Sequence:CCGGTGCGAATGGAGACGATCAAACCTCGAGGTTTGATCGTCTCCATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-709s1c1
Sequence:CCGGGCCCTCCCAAAGGATTTGATACTCGAGTATCAAATCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-2392s1c1
Sequence:CCGGCCTGGGATGAGACCAATCTATCTCGAGATAGATTGGTCTCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1938s1c1
Sequence:CCGGCTCTGCTACAAGGAGGATCTTCTCGAGAAGATCCTCCTTGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-854s1c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1601s1c1
Sequence:CCGGGCGGATATTAGTGTCGTGCAACTCGAGTTGCACGACACTAATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003899
VALIDATED
ARHGEF7 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-878s21c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003899.3-1366s21c1
Sequence:CCGGACTGGGAGGGCGATGACATTACTCGAGTAATGTCATCGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-2261s21c1
Sequence:CCGGGAGTCTTGTGGATACCGTATACTCGAGTATACGGTATCCACAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003899.3-1225s21c1
Sequence:CCGGAGAGACACATGGAGGATTATCCTCGAGGATAATCCTCCATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003899.3-2587s21c1
Sequence:CCGGTGCGAATGGAGACGATCAAACCTCGAGGTTTGATCGTCTCCATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-709s1c1
Sequence:CCGGGCCCTCCCAAAGGATTTGATACTCGAGTATCAAATCCTTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-2392s1c1
Sequence:CCGGCCTGGGATGAGACCAATCTATCTCGAGATAGATTGGTCTCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1938s1c1
Sequence:CCGGCTCTGCTACAAGGAGGATCTTCTCGAGAAGATCCTCCTTGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003899.2-854s1c1
Sequence:CCGGGAAGTTAAGTTCAGCAAACATCTCGAGATGTTTGCTGAACTTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003899.2-1601s1c1
Sequence:CCGGGCGGATATTAGTGTCGTGCAACTCGAGTTGCACGACACTAATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks