EMAIL THIS PAGE TO A FRIEND

ARHGEF9

Cdc42 guanine nucleotide exchange factor (GEF) 9

272 Gene Product Result for
Synonyms: COLLYBISTIN EIEE8 HPEM-2 PEM-2 PEM2
UniProtKB ID: O43307, A8K1S8, B4DHC7, F8W7P8, Q5JSL6
Gene ID:
Human(23229) Summary: The protein encoded by this gene is a Rho-like GTPase that switches between the active (GTP-bound) state and inactive (GDP-bound) state to regulate CDC42 and other genes. Defects in this gene are a cause of startle disease with epilepsy (STHEE), also known as hyperekplexia with epilepsy. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Mouse(236915) CDC42 guanine nucleotide exchange factor (GEF) 9
Rat(66013) Cdc42 guanine nucleotide exchange factor (GEF) 9
chicken(422315) Cdc42 guanine nucleotide exchange factor (GEF) 9
Horse(100054217) Cdc42 guanine nucleotide exchange factor (GEF) 9
domestic cat(101100626) Cdc42 guanine nucleotide exchange factor (GEF) 9
dog(100686228) Cdc42 guanine nucleotide exchange factor (GEF) 9
domestic guinea pig(100733848) Cdc42 guanine nucleotide exchange factor (GEF) 9
naked mole-rat(101719261) Cdc42 guanine nucleotide exchange factor (GEF) 9
sheep(101110030) Cdc42 guanine nucleotide exchange factor (GEF) 9
Domestic Rabbit(100338091) Cdc42 guanine nucleotide exchange factor (GEF) 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050481 MISSION® esiRNA esiRNA human ARHGEF9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015185 Rosetta Predictions human pricing
NM_023957 Rosetta Predictions rat pricing
NM_001033329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228402 predicted 1894
2 SASI_Hs02_00347230 predicted 2010
3 SASI_Hs01_00228403 predicted 1976
4 SASI_Hs01_00228404 predicted 1291
5 SASI_Hs01_00228405 predicted 1397
6 SASI_Hs01_00228406 predicted 1339
7 SASI_Hs01_00228407 predicted 1415
8 SASI_Hs01_00228408 predicted 1578
9 SASI_Hs01_00228409 predicted 2031
10 SASI_Hs01_00228410 predicted 1939
11 SASI_Hs01_00228411 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067711 predicted 1450
2 SASI_Rn01_00067712 predicted 1504
3 SASI_Rn01_00067713 predicted 1581
4 SASI_Rn01_00067714 predicted 402
5 SASI_Rn01_00067715 predicted 1472
6 SASI_Rn01_00067716 predicted 820
7 SASI_Rn01_00067718 predicted 930
8 SASI_Rn01_00067719 predicted 1884
9 SASI_Rn01_00067720 predicted 428
10 SASI_Rn02_00263764 predicted 1322
11 SASI_Rn01_00067717 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129935 predicted 1123
2 SASI_Mm01_00129936 predicted 959
3 SASI_Mm02_00288571 predicted 999
4 SASI_Mm01_00129937 predicted 1497
5 SASI_Mm01_00129938 predicted 1168
6 SASI_Mm01_00129939 predicted 456
7 SASI_Mm01_00129940 predicted 1078
8 SASI_Mm01_00129941 predicted 1195
9 SASI_Mm01_00129942 predicted 879
10 SASI_Mm02_00288572 predicted 977
11 SASI_Mm01_00129934 predicted 1536
12 SASI_Mm01_00129943 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377014
VALIDATED
ARHGEF9 MISSION shRNA Bacterial Glycerol Stock
Cdc42 guanine nucleotide exchange factor (GEF) 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1502s1c1
Sequence:CCGGCGCATTGACATGGATAAATATCTCGAGATATTTATCCATGTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-970s1c1
Sequence:CCGGCCAAGATGGATTCTGGATATACTCGAGTATATCCAGAATCCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1453s1c1
Sequence:CCGGCCTCTGCAAGAAGGACCTAATCTCGAGATTAGGTCCTTCTTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-835s1c1
Sequence:CCGGCGAGCAACTGAAGGTAATCTTCTCGAGAAGATTACCTTCAGTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-1607s1c1
Sequence:CCGGGAGGAGATACATCTGTTCTTTCTCGAGAAAGAACAGATGTATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377014
VALIDATED
ARHGEF9 MISSION shRNA shRNA Plasmid DNA
Cdc42 guanine nucleotide exchange factor (GEF) 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1502s1c1
Sequence:CCGGCGCATTGACATGGATAAATATCTCGAGATATTTATCCATGTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-970s1c1
Sequence:CCGGCCAAGATGGATTCTGGATATACTCGAGTATATCCAGAATCCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1453s1c1
Sequence:CCGGCCTCTGCAAGAAGGACCTAATCTCGAGATTAGGTCCTTCTTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-835s1c1
Sequence:CCGGCGAGCAACTGAAGGTAATCTTCTCGAGAAGATTACCTTCAGTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-1607s1c1
Sequence:CCGGGAGGAGATACATCTGTTCTTTCTCGAGAAAGAACAGATGTATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377014
VALIDATED
ARHGEF9 MISSION shRNA Lentiviral Transduction Particles
Cdc42 guanine nucleotide exchange factor (GEF) 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1502s1c1
Sequence:CCGGCGCATTGACATGGATAAATATCTCGAGATATTTATCCATGTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-970s1c1
Sequence:CCGGCCAAGATGGATTCTGGATATACTCGAGTATATCCAGAATCCATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377014.1-1453s1c1
Sequence:CCGGCCTCTGCAAGAAGGACCTAATCTCGAGATTAGGTCCTTCTTGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-835s1c1
Sequence:CCGGCGAGCAACTGAAGGTAATCTTCTCGAGAAGATTACCTTCAGTTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_377014.1-1607s1c1
Sequence:CCGGGAGGAGATACATCTGTTCTTTCTCGAGAAAGAACAGATGTATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033329
ARHGEF9 MISSION shRNA Bacterial Glycerol Stock
Cdc42 guanine nucleotide exchange factor (GEF) 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1523s21c1
Sequence:CCGGGGCGCATTGACATGGATAAATCTCGAGATTTATCCATGTCAATGCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-994s21c1
Sequence:GTACCGGCAAGATGGATTCTGGATATACCTCGAGGTATATCCAGAATCCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-3852s21c1
Sequence:CCGGTACTTCTTGACCTAGATTAAGCTCGAGCTTAATCTAGGTCAAGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1839s21c1
Sequence:CCGGACCACCACAGGACCCGTTAAACTCGAGTTTAACGGGTCCTGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1495s21c1
Sequence:CCGGATCCGGAGAGACATCCTATACCTCGAGGTATAGGATGTCTCTCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-501s21c1
Sequence:CCGGCAACCGGGAGTTGGCATTTAACTCGAGTTAAATGCCAACTCCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-2853s21c1
Sequence:CCGGGGTGATTTCTTCCCATATAACCTCGAGGTTATATGGGAAGAAATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1076s21c1
Sequence:CCGGGCCGCTATCAACACTTCTTTGCTCGAGCAAAGAAGTGTTGATAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1295s21c1
Sequence:CCGGAGCGACGTCTGGAGAATATTGCTCGAGCAATATTCTCCAGACGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1268s21c1
Sequence:CCGGATGTGACTCAGCAGATCAATGCTCGAGCATTGATCTGCTGAGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033329
ARHGEF9 MISSION shRNA shRNA Plasmid DNA
Cdc42 guanine nucleotide exchange factor (GEF) 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1523s21c1
Sequence:CCGGGGCGCATTGACATGGATAAATCTCGAGATTTATCCATGTCAATGCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-994s21c1
Sequence:GTACCGGCAAGATGGATTCTGGATATACCTCGAGGTATATCCAGAATCCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-3852s21c1
Sequence:CCGGTACTTCTTGACCTAGATTAAGCTCGAGCTTAATCTAGGTCAAGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1839s21c1
Sequence:CCGGACCACCACAGGACCCGTTAAACTCGAGTTTAACGGGTCCTGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1495s21c1
Sequence:CCGGATCCGGAGAGACATCCTATACCTCGAGGTATAGGATGTCTCTCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-501s21c1
Sequence:CCGGCAACCGGGAGTTGGCATTTAACTCGAGTTAAATGCCAACTCCCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-2853s21c1
Sequence:CCGGGGTGATTTCTTCCCATATAACCTCGAGGTTATATGGGAAGAAATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1076s21c1
Sequence:CCGGGCCGCTATCAACACTTCTTTGCTCGAGCAAAGAAGTGTTGATAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1295s21c1
Sequence:CCGGAGCGACGTCTGGAGAATATTGCTCGAGCAATATTCTCCAGACGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1268s21c1
Sequence:CCGGATGTGACTCAGCAGATCAATGCTCGAGCATTGATCTGCTGAGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033329
ARHGEF9 MISSION shRNA Lentiviral Transduction Particles
Cdc42 guanine nucleotide exchange factor (GEF) 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1523s21c1
Sequence:CCGGGGCGCATTGACATGGATAAATCTCGAGATTTATCCATGTCAATGCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-994s21c1
Sequence:GTACCGGCAAGATGGATTCTGGATATACCTCGAGGTATATCCAGAATCCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-3852s21c1
Sequence:CCGGTACTTCTTGACCTAGATTAAGCTCGAGCTTAATCTAGGTCAAGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1839s21c1
Sequence:CCGGACCACCACAGGACCCGTTAAACTCGAGTTTAACGGGTCCTGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1495s21c1
Sequence:CCGGATCCGGAGAGACATCCTATACCTCGAGGTATAGGATGTCTCTCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-501s21c1
Sequence:CCGGCAACCGGGAGTTGGCATTTAACTCGAGTTAAATGCCAACTCCCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033329.2-2853s21c1
Sequence:CCGGGGTGATTTCTTCCCATATAACCTCGAGGTTATATGGGAAGAAATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1076s21c1
Sequence:CCGGGCCGCTATCAACACTTCTTTGCTCGAGCAAAGAAGTGTTGATAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1295s21c1
Sequence:CCGGAGCGACGTCTGGAGAATATTGCTCGAGCAATATTCTCCAGACGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033329.2-1268s21c1
Sequence:CCGGATGTGACTCAGCAGATCAATGCTCGAGCATTGATCTGCTGAGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)