EMAIL THIS PAGE TO A FRIEND

ARID1A

AT rich interactive domain 1A (SWI-like)

188 Gene Product Result for
Synonyms: B120 BAF250 BAF250a BM029 C1orf4 ELD MRD14 OSA1 P270 SMARCF1 hELD hOSA1
Gene ID:
Human(8289) Summary: This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(93760) AT rich interactive domain 1A (SWI-like)
Rat(297867) AT rich interactive domain 1A (SWI-like)
chicken(419542) AT rich interactive domain 1A (SWI-like)
domestic cat(101086737) AT rich interactive domain 1A (SWI-like)
cow(540181) AT rich interactive domain 1A (SWI-like)
dog(487352) AT rich interactive domain 1A (SWI-like)
sheep(101115263) AT rich interactive domain 1A (SWI-like)
naked mole-rat(101715459) AT rich interactive domain 1A (SWI-like)
domestic guinea pig(100714305) AT rich interactive domain 1A (SWI-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006015 Rosetta Predictions human pricing
NM_139135 Rosetta Predictions human pricing
NM_001106635 Rosetta Predictions rat pricing
NM_001080819 Rosetta Predictions mouse pricing
XM_992304 Rosetta Predictions mouse pricing
XM_992330 Rosetta Predictions mouse pricing
XM_992362 Rosetta Predictions mouse pricing
XM_992390 Rosetta Predictions mouse pricing
XM_992408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082879 predicted 6009
2 SASI_Hs01_00082880 predicted 3610
3 SASI_Hs01_00082881 predicted 3961
4 SASI_Hs01_00082883 predicted 3556
5 SASI_Hs02_00340729 predicted 4066
6 SASI_Hs01_00082885 predicted 5500
7 SASI_Hs01_00082887 predicted 4002
8 SASI_Hs02_00340730 predicted 6102
9 SASI_Hs02_00340731 predicted 5804
10 SASI_Hs02_00340732 predicted 2176
11 SASI_Hs01_00082878 predicted 3814
12 SASI_Hs01_00082882 predicted 2599
13 SASI_Hs01_00082884 predicted 6224
14 SASI_Hs01_00082886 predicted 5668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234368 predicted 3808
2 SASI_Hs01_00234370 predicted 5365
3 SASI_Hs01_00234371 predicted 3609
4 SASI_Hs01_00234372 predicted 3955
5 SASI_Hs01_00234373 predicted 2596
6 SASI_Hs01_00234374 predicted 3553
7 SASI_Hs01_00234376 predicted 4067
8 SASI_Hs02_00364148 predicted 4851
9 SASI_Hs02_00364149 predicted 5015
10 SASI_Hs02_00364150 predicted 3993
11 SASI_Hs01_00234369 predicted 4727
12 SASI_Hs01_00234375 predicted 5563
13 SASI_Hs01_00234377 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220888 predicted 3169
2 SASI_Rn02_00220889 predicted 1889
3 SASI_Rn02_00220890 predicted 4534
4 SASI_Rn02_00220891 predicted 2551
5 SASI_Rn02_00220892 predicted 1883
6 SASI_Rn02_00220893 predicted 3788
7 SASI_Rn02_00220894 predicted 4700
8 SASI_Rn02_00220895 predicted 4297
9 SASI_Rn02_00220896 predicted 2099
10 SASI_Rn02_00220897 predicted 4059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293923 predicted 5453
2 SASI_Mm02_00293924 predicted 5238
3 SASI_Mm02_00293925 predicted 5408
4 SASI_Mm02_00293926 predicted 3235
5 SASI_Mm02_00293927 predicted 4737
6 SASI_Mm02_00293928 predicted 2226
7 SASI_Mm02_00293929 predicted 2697
8 SASI_Mm02_00293930 predicted 3014
9 SASI_Mm02_00293931 predicted 5727
10 SASI_Mm02_00293932 predicted 4791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207324 predicted 2199
2 SASI_Mm01_00207325 predicted 1754
3 SASI_Mm01_00207326 predicted 2533
4 SASI_Mm01_00207327 predicted 2530
5 SASI_Mm01_00207328 predicted 2480
6 SASI_Mm01_00207329 predicted 2196
7 SASI_Mm01_00207330 predicted 1412
8 SASI_Mm01_00207331 predicted 1887
9 SASI_Mm01_00207332 predicted 2195
10 SASI_Mm01_00207333 predicted 2487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217495 predicted 5982
2 SASI_Mm01_00217496 predicted 5944
3 SASI_Mm01_00217497 predicted 5972
4 SASI_Mm01_00217498 predicted 6010
5 SASI_Mm01_00217499 predicted 5978
6 SASI_Mm01_00217500 predicted 5932
7 SASI_Mm01_00217501 predicted 5975
8 SASI_Mm01_00217502 predicted 5985
9 SASI_Mm01_00217503 predicted 6003
10 SASI_Mm01_00217504 predicted 5947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255536 predicted 6631
2 SASI_Mm01_00255537 predicted 6597
3 SASI_Mm01_00255538 predicted 6630
4 SASI_Mm01_00255539 predicted 6653
5 SASI_Mm01_00255540 predicted 6636
6 SASI_Mm01_00255541 predicted 6574
7 SASI_Mm01_00255542 predicted 6630
8 SASI_Mm01_00255543 predicted 6638
9 SASI_Mm01_00255544 predicted 6648
10 SASI_Mm01_00255545 predicted 6597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249999 predicted 4518
2 SASI_Mm01_00250000 predicted 4492
3 SASI_Mm01_00250001 predicted 4520
4 SASI_Mm01_00250002 predicted 4543
5 SASI_Mm01_00250003 predicted 4518
6 SASI_Mm01_00250004 predicted 4462
7 SASI_Mm01_00250005 predicted 4518
8 SASI_Mm01_00250006 predicted 4528
9 SASI_Mm01_00250007 predicted 4539
10 SASI_Mm01_00250008 predicted 4482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254474 predicted 6666
2 SASI_Mm01_00254475 predicted 6632
3 SASI_Mm01_00254476 predicted 6664
4 SASI_Mm01_00254477 predicted 6685
5 SASI_Mm01_00254478 predicted 6662
6 SASI_Mm01_00254479 predicted 6609
7 SASI_Mm01_00254480 predicted 6655
8 SASI_Mm01_00254481 predicted 6670
9 SASI_Mm01_00254482 predicted 6683
10 SASI_Mm01_00254483 predicted 6628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006015
VALIDATED
ARID1A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 1A (SWI-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-3519s21c1
Sequence:CCGGTGGACCTCTATCGCCTCTATGCTCGAGCATAGAGGCGATAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4208s21c1
Sequence:CCGGTATCCCTATGGAGGTCCTTATCTCGAGATAAGGACCTCCATAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4874s21c1
Sequence:CCGGCGTAATGACATGACCTATAATCTCGAGATTATAGGTCATGTCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-1765s21c1
Sequence:CCGGACAGGGCCAGACTCCATATTACTCGAGTAATATGGAGTCTGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-7166s21c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006015.3-5342s1c1
Sequence:CCGGCGGCTCACAATGAAAGACATTCTCGAGAATGTCTTTCATTGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2803s1c1
Sequence:CCGGGCAGCCAAACTATAATGCCTTCTCGAGAAGGCATTATAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-7163s1c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-1702s1c1
Sequence:CCGGCCTCTCTTATACACAGCAGATCTCGAGATCTGCTGTGTATAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2287s1c1
Sequence:CCGGGCCTGATCTATCTGGTTCAATCTCGAGATTGAACCAGATAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006015
VALIDATED
ARID1A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 1A (SWI-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-3519s21c1
Sequence:CCGGTGGACCTCTATCGCCTCTATGCTCGAGCATAGAGGCGATAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4208s21c1
Sequence:CCGGTATCCCTATGGAGGTCCTTATCTCGAGATAAGGACCTCCATAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4874s21c1
Sequence:CCGGCGTAATGACATGACCTATAATCTCGAGATTATAGGTCATGTCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-1765s21c1
Sequence:CCGGACAGGGCCAGACTCCATATTACTCGAGTAATATGGAGTCTGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-7166s21c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006015.3-5342s1c1
Sequence:CCGGCGGCTCACAATGAAAGACATTCTCGAGAATGTCTTTCATTGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2803s1c1
Sequence:CCGGGCAGCCAAACTATAATGCCTTCTCGAGAAGGCATTATAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-7163s1c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-1702s1c1
Sequence:CCGGCCTCTCTTATACACAGCAGATCTCGAGATCTGCTGTGTATAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2287s1c1
Sequence:CCGGGCCTGATCTATCTGGTTCAATCTCGAGATTGAACCAGATAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006015
VALIDATED
ARID1A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 1A (SWI-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-3519s21c1
Sequence:CCGGTGGACCTCTATCGCCTCTATGCTCGAGCATAGAGGCGATAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4208s21c1
Sequence:CCGGTATCCCTATGGAGGTCCTTATCTCGAGATAAGGACCTCCATAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-4874s21c1
Sequence:CCGGCGTAATGACATGACCTATAATCTCGAGATTATAGGTCATGTCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-1765s21c1
Sequence:CCGGACAGGGCCAGACTCCATATTACTCGAGTAATATGGAGTCTGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006015.4-7166s21c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006015.3-5342s1c1
Sequence:CCGGCGGCTCACAATGAAAGACATTCTCGAGAATGTCTTTCATTGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2803s1c1
Sequence:CCGGGCAGCCAAACTATAATGCCTTCTCGAGAAGGCATTATAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-7163s1c1
Sequence:CCGGCCGTTGATGAACTCATTGGTTCTCGAGAACCAATGAGTTCATCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-1702s1c1
Sequence:CCGGCCTCTCTTATACACAGCAGATCTCGAGATCTGCTGTGTATAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006015.3-2287s1c1
Sequence:CCGGGCCTGATCTATCTGGTTCAATCTCGAGATTGAACCAGATAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080819
VALIDATED
ARID1A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080819.1-7749s21c1
Sequence:CCGGCTTTATAGTATGGCGAGTTAACTCGAGTTAACTCGCCATACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080819.1-2431s21c1
Sequence:CCGGCCTAGGCAGCCTAACTATAATCTCGAGATTATAGTTAGGCTGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-2598s21c1
Sequence:CCGGCAGGCCCTATGGCCCTAATATCTCGAGATATTAGGGCCATAGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-5059s21c1
Sequence:CCGGTGGGCGTTAGACACCATTAACCTCGAGGTTAATGGTGTCTAACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080819.1-2241s21c1
Sequence:CCGGTGCCCAAGATCGAGGTTATATCTCGAGATATAACCTCGATCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080819
VALIDATED
ARID1A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080819.1-7749s21c1
Sequence:CCGGCTTTATAGTATGGCGAGTTAACTCGAGTTAACTCGCCATACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080819.1-2431s21c1
Sequence:CCGGCCTAGGCAGCCTAACTATAATCTCGAGATTATAGTTAGGCTGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-2598s21c1
Sequence:CCGGCAGGCCCTATGGCCCTAATATCTCGAGATATTAGGGCCATAGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-5059s21c1
Sequence:CCGGTGGGCGTTAGACACCATTAACCTCGAGGTTAATGGTGTCTAACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080819.1-2241s21c1
Sequence:CCGGTGCCCAAGATCGAGGTTATATCTCGAGATATAACCTCGATCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080819
VALIDATED
ARID1A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080819.1-7749s21c1
Sequence:CCGGCTTTATAGTATGGCGAGTTAACTCGAGTTAACTCGCCATACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080819.1-2431s21c1
Sequence:CCGGCCTAGGCAGCCTAACTATAATCTCGAGATTATAGTTAGGCTGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-2598s21c1
Sequence:CCGGCAGGCCCTATGGCCCTAATATCTCGAGATATTAGGGCCATAGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080819.1-5059s21c1
Sequence:CCGGTGGGCGTTAGACACCATTAACCTCGAGGTTAATGGTGTCTAACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080819.1-2241s21c1
Sequence:CCGGTGCCCAAGATCGAGGTTATATCTCGAGATATAACCTCGATCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033566
ARID1A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5198s1c1
Sequence:CCGGCCCAGAGATTGGTCTTGGAAACTCGAGTTTCCAAGACCAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-2519s1c1
Sequence:CCGGGCATGTCCTATGAGCCAAATACTCGAGTATTTGGCTCATAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5663s1c1
Sequence:CCGGCATTGGTTTCACAAGTCATTTCTCGAGAAATGACTTGTGAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-771s1c1
Sequence:CCGGGCCTGATCTGTCTGGTTCAATCTCGAGATTGAACCAGACAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-3367s1c1
Sequence:CCGGCGAAATGACATGACCTACAATCTCGAGATTGTAGGTCATGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033566
ARID1A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5198s1c1
Sequence:CCGGCCCAGAGATTGGTCTTGGAAACTCGAGTTTCCAAGACCAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-2519s1c1
Sequence:CCGGGCATGTCCTATGAGCCAAATACTCGAGTATTTGGCTCATAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5663s1c1
Sequence:CCGGCATTGGTTTCACAAGTCATTTCTCGAGAAATGACTTGTGAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-771s1c1
Sequence:CCGGGCCTGATCTGTCTGGTTCAATCTCGAGATTGAACCAGACAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-3367s1c1
Sequence:CCGGCGAAATGACATGACCTACAATCTCGAGATTGTAGGTCATGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033566
ARID1A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 1A (SWI-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5198s1c1
Sequence:CCGGCCCAGAGATTGGTCTTGGAAACTCGAGTTTCCAAGACCAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-2519s1c1
Sequence:CCGGGCATGTCCTATGAGCCAAATACTCGAGTATTTGGCTCATAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-5663s1c1
Sequence:CCGGCATTGGTTTCACAAGTCATTTCTCGAGAAATGACTTGTGAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-771s1c1
Sequence:CCGGGCCTGATCTGTCTGGTTCAATCTCGAGATTGAACCAGACAGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033566.1-3367s1c1
Sequence:CCGGCGAAATGACATGACCTACAATCTCGAGATTGTAGGTCATGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks