EMAIL THIS PAGE TO A FRIEND

ARID1B

AT rich interactive domain 1B (SWI1-like)

190 Gene Product Result for
Synonyms: 6A3-5 BAF250B BRIGHT DAN15 ELD/OSA1 MRD12 OSA2 P250R
Gene ID:
Human(57492) Summary: This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2012]
Mouse(239985) AT rich interactive domain 1B (SWI-like)
Rat(282546) AT rich interactive domain 1B (Swi1 like)
Zebrafish(569589) AT rich interactive domain 1B (SWI1-like)
cow(505229) AT rich interactive domain 1B (SWI1-like)
Horse(100061001) AT rich interactive domain 1B (SWI1-like)
chicken(421650) AT rich interactive domain 1B (SWI1-like)
dog(484047) AT rich interactive domain 1B (SWI1-like)
domestic guinea pig(100715594) AT rich interactive domain 1B (SWI1-like)
naked mole-rat(101712535) AT rich interactive domain 1B (SWI1-like)
sheep(101108839) AT rich interactive domain 1B (SWI1-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017519 Rosetta Predictions human pricing
NM_020732 Rosetta Predictions human pricing
NM_175863 Rosetta Predictions human pricing
NM_172157 Rosetta Predictions rat pricing
NM_001085355 Rosetta Predictions mouse pricing
XM_139711 Rosetta Predictions mouse pricing
XM_888675 Rosetta Predictions mouse pricing
XM_898196 Rosetta Predictions mouse pricing
XM_983162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350141 predicted 2739
2 SASI_Hs01_00184333 predicted 2467
3 SASI_Hs01_00184334 predicted 3678
4 SASI_Hs01_00184335 predicted 5797
5 SASI_Hs01_00184336 predicted 5455
6 SASI_Hs02_00350142 predicted 6205
7 SASI_Hs01_00184337 predicted 4091
8 SASI_Hs01_00184338 predicted 5942
9 SASI_Hs01_00184339 predicted 2195
10 SASI_Hs01_00184340 predicted 2407
11 SASI_Hs01_00184332 predicted 5937
12 SASI_Hs01_00184341 predicted 2349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353814 predicted 2784
2 SASI_Hs01_00197072 predicted 2507
3 SASI_Hs01_00197073 predicted 3560
4 SASI_Hs01_00197074 predicted 5673
5 SASI_Hs01_00197075 predicted 5335
6 SASI_Hs02_00353815 predicted 6078
7 SASI_Hs01_00197076 predicted 3968
8 SASI_Hs01_00197077 predicted 5817
9 SASI_Hs01_00197078 predicted 2231
10 SASI_Hs01_00197079 predicted 2446
11 SASI_Hs01_00197071 predicted 5812
12 SASI_Hs01_00197080 predicted 2389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369139 predicted 2741
2 SASI_Hs01_00073743 predicted 2473
3 SASI_Hs01_00073744 predicted 3520
4 SASI_Hs01_00073745 predicted 5632
5 SASI_Hs01_00073746 predicted 5290
6 SASI_Hs02_00369140 predicted 6043
7 SASI_Hs01_00073747 predicted 3936
8 SASI_Hs01_00073748 predicted 5782
9 SASI_Hs01_00073749 predicted 2196
10 SASI_Hs01_00073750 predicted 2404
11 SASI_Hs01_00073742 predicted 5773
12 SASI_Hs01_00073751 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088419 predicted 895
2 SASI_Rn01_00088420 predicted 2259
3 SASI_Rn01_00088421 predicted 4474
4 SASI_Rn01_00088422 predicted 1119
5 SASI_Rn01_00088423 predicted 3334
6 SASI_Rn01_00088424 predicted 1402
7 SASI_Rn01_00088425 predicted 3038
8 SASI_Rn01_00088426 predicted 2221
9 SASI_Rn01_00088427 predicted 772
10 SASI_Rn01_00088428 predicted 4924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300205 predicted 3588
2 SASI_Mm02_00300206 predicted 3331
3 SASI_Mm02_00300207 predicted 2313
4 SASI_Mm02_00300208 predicted 2562
5 SASI_Mm02_00300209 predicted 3168
6 SASI_Mm02_00300210 predicted 3995
7 SASI_Mm02_00300211 predicted 2596
8 SASI_Mm02_00300212 predicted 2854
9 SASI_Mm02_00300213 predicted 3662
10 SASI_Mm02_00300214 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208606 predicted 3590
2 SASI_Mm01_00208607 predicted 3341
3 SASI_Mm01_00208608 predicted 2318
4 SASI_Mm01_00208609 predicted 2566
5 SASI_Mm01_00208610 predicted 3172
6 SASI_Mm01_00208611 predicted 4002
7 SASI_Mm01_00208612 predicted 2856
8 SASI_Mm01_00208613 predicted 3673
9 SASI_Mm01_00208614 predicted 2877
10 SASI_Mm01_00208615 predicted 6122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283623 predicted 3468
2 SASI_Mm01_00283624 predicted 3213
3 SASI_Mm01_00283625 predicted 2354
4 SASI_Mm01_00283626 predicted 2603
5 SASI_Mm01_00283627 predicted 3048
6 SASI_Mm01_00283628 predicted 3881
7 SASI_Mm01_00283629 predicted 2894
8 SASI_Mm01_00283630 predicted 3552
9 SASI_Mm01_00283631 predicted 2909
10 SASI_Mm01_00283632 predicted 6002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272668 predicted 569
2 SASI_Mm01_00272669 predicted 781
3 SASI_Mm01_00272670 predicted 866
4 SASI_Mm01_00272671 predicted 856
5 SASI_Mm01_00272672 predicted 528
6 SASI_Mm01_00272673 predicted 879
7 SASI_Mm01_00272674 predicted 782
8 SASI_Mm01_00272675 predicted 783
9 SASI_Mm01_00272676 predicted 713
10 SASI_Mm01_00272677 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264142 predicted 2160
2 SASI_Mm01_00264143 predicted 1896
3 SASI_Mm01_00264144 predicted 883
4 SASI_Mm01_00264145 predicted 1131
5 SASI_Mm01_00264146 predicted 1728
6 SASI_Mm01_00264147 predicted 2572
7 SASI_Mm01_00264148 predicted 1417
8 SASI_Mm01_00264149 predicted 2235
9 SASI_Mm01_00264150 predicted 1441
10 SASI_Mm01_00264151 predicted 4677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017519
ARID1B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 1B (SWI1-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017519.1-7426s1c1
Sequence:CCGGCCACAGGAATATGGTTCCATTCTCGAGAATGGAACCATATTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4497s1c1
Sequence:CCGGGCACGCAATGATATGCCTTATCTCGAGATAAGGCATATCATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-3527s1c1
Sequence:CCGGGCAGTATATTCAGTACCTGTTCTCGAGAACAGGTACTGAATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4823s1c1
Sequence:CCGGGCCGTCTATGAAGATGCAGAACTCGAGTTCTGCATCTTCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4205s1c1
Sequence:CCGGGCCGAATTACAAACGCCATATCTCGAGATATGGCGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-7097s21c1
Sequence:CCGGTGCTGTCTAGTGCATTCAAAGCTCGAGCTTTGAATGCACTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-5054s21c1
Sequence:CCGGGTGGGCTTTGGACACTATTAACTCGAGTTAATAGTGTCCAAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-6172s21c1
Sequence:CCGGTGGTCACGTTGGCCAACATTTCTCGAGAAATGTTGGCCAACGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-3431s21c1
Sequence:CCGGGGGTTTGGCCCAGGTTAATAACTCGAGTTATTAACCTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-6878s21c1
Sequence:CCGGGAAGATTAGAGGGTCACATATCTCGAGATATGTGACCCTCTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017519
ARID1B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 1B (SWI1-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017519.1-7426s1c1
Sequence:CCGGCCACAGGAATATGGTTCCATTCTCGAGAATGGAACCATATTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4497s1c1
Sequence:CCGGGCACGCAATGATATGCCTTATCTCGAGATAAGGCATATCATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-3527s1c1
Sequence:CCGGGCAGTATATTCAGTACCTGTTCTCGAGAACAGGTACTGAATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4823s1c1
Sequence:CCGGGCCGTCTATGAAGATGCAGAACTCGAGTTCTGCATCTTCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4205s1c1
Sequence:CCGGGCCGAATTACAAACGCCATATCTCGAGATATGGCGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-7097s21c1
Sequence:CCGGTGCTGTCTAGTGCATTCAAAGCTCGAGCTTTGAATGCACTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-5054s21c1
Sequence:CCGGGTGGGCTTTGGACACTATTAACTCGAGTTAATAGTGTCCAAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-6172s21c1
Sequence:CCGGTGGTCACGTTGGCCAACATTTCTCGAGAAATGTTGGCCAACGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-3431s21c1
Sequence:CCGGGGGTTTGGCCCAGGTTAATAACTCGAGTTATTAACCTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-6878s21c1
Sequence:CCGGGAAGATTAGAGGGTCACATATCTCGAGATATGTGACCCTCTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017519
ARID1B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 1B (SWI1-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017519.1-7426s1c1
Sequence:CCGGCCACAGGAATATGGTTCCATTCTCGAGAATGGAACCATATTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4497s1c1
Sequence:CCGGGCACGCAATGATATGCCTTATCTCGAGATAAGGCATATCATTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-3527s1c1
Sequence:CCGGGCAGTATATTCAGTACCTGTTCTCGAGAACAGGTACTGAATATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4823s1c1
Sequence:CCGGGCCGTCTATGAAGATGCAGAACTCGAGTTCTGCATCTTCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017519.1-4205s1c1
Sequence:CCGGGCCGAATTACAAACGCCATATCTCGAGATATGGCGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-7097s21c1
Sequence:CCGGTGCTGTCTAGTGCATTCAAAGCTCGAGCTTTGAATGCACTAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-5054s21c1
Sequence:CCGGGTGGGCTTTGGACACTATTAACTCGAGTTAATAGTGTCCAAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-6172s21c1
Sequence:CCGGTGGTCACGTTGGCCAACATTTCTCGAGAAATGTTGGCCAACGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017519.1-3431s21c1
Sequence:CCGGGGGTTTGGCCCAGGTTAATAACTCGAGTTATTAACCTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017519.1-6878s21c1
Sequence:CCGGGAAGATTAGAGGGTCACATATCTCGAGATATGTGACCCTCTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085355
ARID1B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 1B (SWI1-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085355.1-8368s21c1
Sequence:CCGGCTCAGATTGTTTAGCTAATTACTCGAGTAATTAGCTAAACAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-5007s21c1
Sequence:CCGGCGTCGCCACCTTCAATCTTTCCTCGAGGAAAGATTGAAGGTGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-4113s21c1
Sequence:CCGGGCCGAATTACAAACGTCATATCTCGAGATATGACGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-3338s21c1
Sequence:CCGGGAGGTTTGGCGCAGGTTAATACTCGAGTATTAACCTGCGCCAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-6080s21c1
Sequence:CCGGTGGTCACGTTGGCGAACATTTCTCGAGAAATGTTCGCCAACGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085355
ARID1B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 1B (SWI1-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085355.1-8368s21c1
Sequence:CCGGCTCAGATTGTTTAGCTAATTACTCGAGTAATTAGCTAAACAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-5007s21c1
Sequence:CCGGCGTCGCCACCTTCAATCTTTCCTCGAGGAAAGATTGAAGGTGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-4113s21c1
Sequence:CCGGGCCGAATTACAAACGTCATATCTCGAGATATGACGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-3338s21c1
Sequence:CCGGGAGGTTTGGCGCAGGTTAATACTCGAGTATTAACCTGCGCCAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-6080s21c1
Sequence:CCGGTGGTCACGTTGGCGAACATTTCTCGAGAAATGTTCGCCAACGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085355
ARID1B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 1B (SWI1-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085355.1-8368s21c1
Sequence:CCGGCTCAGATTGTTTAGCTAATTACTCGAGTAATTAGCTAAACAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-5007s21c1
Sequence:CCGGCGTCGCCACCTTCAATCTTTCCTCGAGGAAAGATTGAAGGTGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-4113s21c1
Sequence:CCGGGCCGAATTACAAACGTCATATCTCGAGATATGACGTTTGTAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-3338s21c1
Sequence:CCGGGAGGTTTGGCGCAGGTTAATACTCGAGTATTAACCTGCGCCAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085355.1-6080s21c1
Sequence:CCGGTGGTCACGTTGGCGAACATTTCTCGAGAAATGTTCGCCAACGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks