EMAIL THIS PAGE TO A FRIEND

ARID2

AT rich interactive domain 2 (ARID, RFX-like)

203 Gene Product Result for
Synonyms: BAF200 p200
Gene ID:
Human(196528) Summary: ARID2 is a subunit of the PBAF chromatin-remodeling complex (see BAF180; MIM 606083), which facilitates ligand-dependent transcriptional activation by nuclear receptors (Yan et al., 2005 [PubMed 15985610]
Mouse(77044) AT rich interactive domain 2 (ARID, RFX-like)
Rat(366980) AT rich interactive domain 2 (Arid-rfx like)
sheep(101112969) AT rich interactive domain 2 (ARID, RFX-like)
naked mole-rat(101718287) AT rich interactive domain 2 (ARID, RFX-like)
domestic guinea pig(100726970) AT rich interactive domain 2 (ARID, RFX-like)
Zebrafish(566352) AT rich interactive domain 2 (ARID, RFX-like)
cow(517876) AT rich interactive domain 2 (ARID, RFX-like)
Horse(100055426) AT rich interactive domain 2 (ARID, RFX-like)
domestic cat(101082579) AT rich interactive domain 2 (ARID, RFX-like)
dog(100688573) AT rich interactive domain 2 (ARID, RFX-like)
chicken(417804) AT rich interactive domain 2 (ARID, RFX-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152641 Rosetta Predictions human pricing
XM_001059099 Rosetta Predictions rat pricing
XM_345867 Rosetta Predictions rat pricing
NM_175251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089681 predicted 683
2 SASI_Hs01_00089683 predicted 514
3 SASI_Hs01_00089684 predicted 2788
4 SASI_Hs01_00089685 predicted 1852
5 SASI_Hs02_00366528 predicted 3675
6 SASI_Hs01_00089688 predicted 431
7 SASI_Hs01_00089689 predicted 3944
8 SASI_Hs02_00366529 predicted 5380
9 SASI_Hs01_00089690 predicted 810
10 SASI_Hs02_00366530 predicted 1254
11 SASI_Hs01_00089682 predicted 1330
12 SASI_Hs01_00089686 predicted 4685
13 SASI_Hs01_00089687 predicted 4322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291924 predicted 3422
2 SASI_Rn02_00291925 predicted 1875
3 SASI_Rn02_00291926 predicted 1240
4 SASI_Rn02_00291927 predicted 4281
5 SASI_Rn02_00291928 predicted 2451
6 SASI_Rn02_00291929 predicted 5422
7 SASI_Rn02_00291930 predicted 1686
8 SASI_Rn02_00291931 predicted 693
9 SASI_Rn02_00291932 predicted 295
10 SASI_Rn02_00291933 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398767 predicted 3429
2 SASI_Rn02_00398768 predicted 1873
3 SASI_Rn02_00398769 predicted 1243
4 SASI_Rn02_00398770 predicted 4280
5 SASI_Rn02_00398771 predicted 2451
6 SASI_Rn02_00398772 predicted 5426
7 SASI_Rn02_00398773 predicted 1688
8 SASI_Rn02_00398774 predicted 689
9 SASI_Rn02_00398775 predicted 295
10 SASI_Rn02_00398776 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345951 predicted 1880
2 SASI_Mm02_00345952 predicted 636
3 SASI_Mm02_00345953 predicted 3642
4 SASI_Mm02_00345954 predicted 4528
5 SASI_Mm02_00345955 predicted 680
6 SASI_Mm02_00345956 predicted 334
7 SASI_Mm02_00345957 predicted 4868
8 SASI_Mm02_00345958 predicted 1894
9 SASI_Mm02_00345959 predicted 390
10 SASI_Mm02_00345960 predicted 3614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175251
VALIDATED
ARID2 MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 2 (ARID, RFX-like)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-1068s21c1
Sequence:CCGGTCGCTTGTCAGTGGCTAAATGCTCGAGCATTTAGCCACTGACAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175251.2-5535s21c1
Sequence:CCGGTTCTTACTTGAGCCAATATATCTCGAGATATATTGGCTCAAGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-4788s21c1
Sequence:GTACCGGGACTAACAGCTGCCTTAATATCTCGAGATATTAAGGCAGCTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175251.2-2925s21c1
Sequence:CCGGCCGTGCCCATTTCGAACTTACCTCGAGGTAAGTTCGAAATGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-2425s21c1
Sequence:CCGGACCTGTCCCGCCTACTAATAACTCGAGTTATTAGTAGGCGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175251.1-3149s1c1
Sequence:CCGGCGGCAGAGGTTCTCTTTCATTCTCGAGAATGAAAGAGAACCTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175251
VALIDATED
ARID2 MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 2 (ARID, RFX-like)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-1068s21c1
Sequence:CCGGTCGCTTGTCAGTGGCTAAATGCTCGAGCATTTAGCCACTGACAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175251.2-5535s21c1
Sequence:CCGGTTCTTACTTGAGCCAATATATCTCGAGATATATTGGCTCAAGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-4788s21c1
Sequence:GTACCGGGACTAACAGCTGCCTTAATATCTCGAGATATTAAGGCAGCTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175251.2-2925s21c1
Sequence:CCGGCCGTGCCCATTTCGAACTTACCTCGAGGTAAGTTCGAAATGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-2425s21c1
Sequence:CCGGACCTGTCCCGCCTACTAATAACTCGAGTTATTAGTAGGCGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175251.1-3149s1c1
Sequence:CCGGCGGCAGAGGTTCTCTTTCATTCTCGAGAATGAAAGAGAACCTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175251
VALIDATED
ARID2 MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 2 (ARID, RFX-like)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-1068s21c1
Sequence:CCGGTCGCTTGTCAGTGGCTAAATGCTCGAGCATTTAGCCACTGACAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175251.2-5535s21c1
Sequence:CCGGTTCTTACTTGAGCCAATATATCTCGAGATATATTGGCTCAAGTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-4788s21c1
Sequence:GTACCGGGACTAACAGCTGCCTTAATATCTCGAGATATTAAGGCAGCTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175251.2-2925s21c1
Sequence:CCGGCCGTGCCCATTTCGAACTTACCTCGAGGTAAGTTCGAAATGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175251.2-2425s21c1
Sequence:CCGGACCTGTCCCGCCTACTAATAACTCGAGTTATTAGTAGGCGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175251.1-3149s1c1
Sequence:CCGGCGGCAGAGGTTCTCTTTCATTCTCGAGAATGAAAGAGAACCTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152641
VALIDATED
ARID2 MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 2 (ARID, RFX-like)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-5304s1c1
Sequence:CCGGCCGACTAACAGCTGCCTTAATCTCGAGATTAAGGCAGCTGTTAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-928s1c1
Sequence:CCGGCGTACCTGTCTTCGTTTCCTACTCGAGTAGGAAACGAAGACAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-416s1c1
Sequence:CCGGCGGATTATCTGCGTCAAAGTTCTCGAGAACTTTGACGCAGATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-4241s1c1
Sequence:CCGGGAATTTCTAATGGACCTGTATCTCGAGATACAGGTCCATTAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-2222s1c1
Sequence:CCGGGTTCTGTTGTTCAGAATCATACTCGAGTATGATTCTGAACAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-5058s1c1
Sequence:CCGGGCAGGATAAGCACTGTTCAAACTCGAGTTTGAACAGTGCTTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-6771s1c1
Sequence:CCGGCCAGCGTGAAATGTATCCATTCTCGAGAATGGATACATTTCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152641.2-7584s1c1
Sequence:CCGGCCGCTGAAATCATGTGGGTATCTCGAGATACCCACATGATTTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-3913s1c1
Sequence:CCGGCCTCCTTCAAACTCAGGGAAACTCGAGTTTCCCTGAGTTTGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152641
VALIDATED
ARID2 MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 2 (ARID, RFX-like)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-5304s1c1
Sequence:CCGGCCGACTAACAGCTGCCTTAATCTCGAGATTAAGGCAGCTGTTAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-928s1c1
Sequence:CCGGCGTACCTGTCTTCGTTTCCTACTCGAGTAGGAAACGAAGACAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-416s1c1
Sequence:CCGGCGGATTATCTGCGTCAAAGTTCTCGAGAACTTTGACGCAGATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-4241s1c1
Sequence:CCGGGAATTTCTAATGGACCTGTATCTCGAGATACAGGTCCATTAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-2222s1c1
Sequence:CCGGGTTCTGTTGTTCAGAATCATACTCGAGTATGATTCTGAACAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-5058s1c1
Sequence:CCGGGCAGGATAAGCACTGTTCAAACTCGAGTTTGAACAGTGCTTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-6771s1c1
Sequence:CCGGCCAGCGTGAAATGTATCCATTCTCGAGAATGGATACATTTCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152641.2-7584s1c1
Sequence:CCGGCCGCTGAAATCATGTGGGTATCTCGAGATACCCACATGATTTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-3913s1c1
Sequence:CCGGCCTCCTTCAAACTCAGGGAAACTCGAGTTTCCCTGAGTTTGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152641
VALIDATED
ARID2 MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 2 (ARID, RFX-like)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-5304s1c1
Sequence:CCGGCCGACTAACAGCTGCCTTAATCTCGAGATTAAGGCAGCTGTTAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-928s1c1
Sequence:CCGGCGTACCTGTCTTCGTTTCCTACTCGAGTAGGAAACGAAGACAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-416s1c1
Sequence:CCGGCGGATTATCTGCGTCAAAGTTCTCGAGAACTTTGACGCAGATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-4241s1c1
Sequence:CCGGGAATTTCTAATGGACCTGTATCTCGAGATACAGGTCCATTAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-2222s1c1
Sequence:CCGGGTTCTGTTGTTCAGAATCATACTCGAGTATGATTCTGAACAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-5058s1c1
Sequence:CCGGGCAGGATAAGCACTGTTCAAACTCGAGTTTGAACAGTGCTTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152641.2-6771s1c1
Sequence:CCGGCCAGCGTGAAATGTATCCATTCTCGAGAATGGATACATTTCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152641.2-7584s1c1
Sequence:CCGGCCGCTGAAATCATGTGGGTATCTCGAGATACCCACATGATTTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152641.2-3913s1c1
Sequence:CCGGCCTCCTTCAAACTCAGGGAAACTCGAGTTTCCCTGAGTTTGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks