EMAIL THIS PAGE TO A FRIEND

ARID3A

AT rich interactive domain 3A (BRIGHT-like)

95 Gene Product Result for
Synonyms: BRIGHT DRIL1 DRIL3 E2FBP1
UniProtKB ID: Q99856, Q5I858, Q6P9C6, Q8IZA7, Q8N4Z3
Gene ID:
Human(1820) Summary: This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA binding proteins. It was found by homology to the Drosophila dead ringer gene, which is important for normal embryogenesis. Other ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation, and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
Mouse(13496) AT rich interactive domain 3A (BRIGHT-like)
Rat(314616) AT rich interactive domain 3A (Bright like)
Zebrafish(569444) AT-rich interactive domain-containing protein 3A
cow(511283) AT rich interactive domain 3A (BRIGHT-like)
domestic cat(101084171) AT rich interactive domain 3A (BRIGHT-like)
dog(612370) AT rich interactive domain 3A (BRIGHT-like)
chicken(100858440) AT rich interactive domain 3A (BRIGHT-like)
domestic guinea pig(100722199) AT rich interactive domain 3A (BRIGHT-like)
naked mole-rat(101712132) AT rich interactive domain 3A (BRIGHT-like)
sheep(101111883) AT rich interactive domain 3A (BRIGHT-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005224 Rosetta Predictions human pricing
NM_001108066 Rosetta Predictions rat pricing
NM_007880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116865 predicted 1187
2 SASI_Hs02_00339211 predicted 1437
3 SASI_Hs01_00116868 predicted 1222
4 SASI_Hs01_00116869 predicted 1086
5 SASI_Hs01_00116870 predicted 1023
6 SASI_Hs01_00116871 predicted 1158
7 SASI_Hs01_00116872 predicted 1096
8 SASI_Hs01_00116873 predicted 1015
9 SASI_Hs01_00116874 predicted 1347
10 SASI_Hs02_00339212 predicted 1080
11 SASI_Hs01_00116866 predicted 1251
12 SASI_Hs01_00116867 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235014 predicted 1750
2 SASI_Rn02_00235015 predicted 1709
3 SASI_Rn02_00235016 predicted 1327
4 SASI_Rn02_00235017 predicted 1776
5 SASI_Rn02_00235018 predicted 1733
6 SASI_Rn02_00235019 predicted 1718
7 SASI_Rn02_00235020 predicted 1646
8 SASI_Rn02_00235021 predicted 1717
9 SASI_Rn02_00235022 predicted 1660
10 SASI_Rn02_00235023 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133461 predicted 1611
2 SASI_Mm01_00133462 predicted 1181
3 SASI_Mm01_00133463 predicted 583
4 SASI_Mm01_00133464 predicted 593
5 SASI_Mm01_00133465 predicted 2050
6 SASI_Mm02_00312665 predicted 1125
7 SASI_Mm01_00133466 predicted 2011
8 SASI_Mm01_00133467 predicted 2023
9 SASI_Mm01_00133468 predicted 450
10 SASI_Mm01_00133470 predicted 1997
11 SASI_Mm01_00133469 predicted 1387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007880
ARID3A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3A (BRIGHT-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007880.1-3435s1c1
Sequence:CCGGGCCTGGTCTTACAGTTAATTTCTCGAGAAATTAACTGTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1818s1c1
Sequence:CCGGCGGGAGCAACAGTATTAGCATCTCGAGATGCTAATACTGTTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1086s1c1
Sequence:CCGGCGACCTGTTCATGTTGTATGTCTCGAGACATACAACATGAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1083s1c1
Sequence:CCGGCCTCGACCTGTTCATGTTGTACTCGAGTACAACATGAACAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-609s1c1
Sequence:CCGGTGAGGGAGATAGGCATTTGATCTCGAGATCAAATGCCTATCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007880
ARID3A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3A (BRIGHT-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007880.1-3435s1c1
Sequence:CCGGGCCTGGTCTTACAGTTAATTTCTCGAGAAATTAACTGTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1818s1c1
Sequence:CCGGCGGGAGCAACAGTATTAGCATCTCGAGATGCTAATACTGTTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1086s1c1
Sequence:CCGGCGACCTGTTCATGTTGTATGTCTCGAGACATACAACATGAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1083s1c1
Sequence:CCGGCCTCGACCTGTTCATGTTGTACTCGAGTACAACATGAACAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-609s1c1
Sequence:CCGGTGAGGGAGATAGGCATTTGATCTCGAGATCAAATGCCTATCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007880
ARID3A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3A (BRIGHT-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007880.1-3435s1c1
Sequence:CCGGGCCTGGTCTTACAGTTAATTTCTCGAGAAATTAACTGTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1818s1c1
Sequence:CCGGCGGGAGCAACAGTATTAGCATCTCGAGATGCTAATACTGTTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1086s1c1
Sequence:CCGGCGACCTGTTCATGTTGTATGTCTCGAGACATACAACATGAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-1083s1c1
Sequence:CCGGCCTCGACCTGTTCATGTTGTACTCGAGTACAACATGAACAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007880.1-609s1c1
Sequence:CCGGTGAGGGAGATAGGCATTTGATCTCGAGATCAAATGCCTATCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005224
VALIDATED
ARID3A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3A (BRIGHT-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-867s1c1
Sequence:CCGGTGGACTTACGAGGAGCAGTTTCTCGAGAAACTGCTCCTCGTAAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1382s1c1
Sequence:CCGGCCCTAAGATCAAGAAAGAGGACTCGAGTCCTCTTTCTTGATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-2498s1c1
Sequence:CCGGCCCTGAACCAAGATCACTGAACTCGAGTTCAGTGATCTTGGTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-932s1c1
Sequence:CCGGCCTGGATGACTTGTTCAGCTTCTCGAGAAGCTGAACAAGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1960s1c1
Sequence:CCGGCCTCAAATAACTCGTTGCCTTCTCGAGAAGGCAACGAGTTATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2466s21c1
Sequence:CCGGCCGATCCTGTTTACCTCATACCTCGAGGTATGAGGTAAACAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005224.2-1918s21c1
Sequence:CCGGCAACCTCTGCTCCCAACAAAGCTCGAGCTTTGTTGGGAGCAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-959s21c1
Sequence:CCGGGACTTACGAGGAGCAGTTTAACTCGAGTTAAACTGCTCCTCGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2040s21c1
Sequence:CCGGTCCACATCTACCTCAAATAACCTCGAGGTTATTTGAGGTAGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-650s21c1
Sequence:CCGGCGAGGACATGAAGCCCAAATGCTCGAGCATTTGGGCTTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005224
VALIDATED
ARID3A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3A (BRIGHT-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-867s1c1
Sequence:CCGGTGGACTTACGAGGAGCAGTTTCTCGAGAAACTGCTCCTCGTAAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1382s1c1
Sequence:CCGGCCCTAAGATCAAGAAAGAGGACTCGAGTCCTCTTTCTTGATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-2498s1c1
Sequence:CCGGCCCTGAACCAAGATCACTGAACTCGAGTTCAGTGATCTTGGTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-932s1c1
Sequence:CCGGCCTGGATGACTTGTTCAGCTTCTCGAGAAGCTGAACAAGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1960s1c1
Sequence:CCGGCCTCAAATAACTCGTTGCCTTCTCGAGAAGGCAACGAGTTATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2466s21c1
Sequence:CCGGCCGATCCTGTTTACCTCATACCTCGAGGTATGAGGTAAACAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005224.2-1918s21c1
Sequence:CCGGCAACCTCTGCTCCCAACAAAGCTCGAGCTTTGTTGGGAGCAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-959s21c1
Sequence:CCGGGACTTACGAGGAGCAGTTTAACTCGAGTTAAACTGCTCCTCGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2040s21c1
Sequence:CCGGTCCACATCTACCTCAAATAACCTCGAGGTTATTTGAGGTAGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-650s21c1
Sequence:CCGGCGAGGACATGAAGCCCAAATGCTCGAGCATTTGGGCTTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005224
VALIDATED
ARID3A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3A (BRIGHT-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-867s1c1
Sequence:CCGGTGGACTTACGAGGAGCAGTTTCTCGAGAAACTGCTCCTCGTAAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1382s1c1
Sequence:CCGGCCCTAAGATCAAGAAAGAGGACTCGAGTCCTCTTTCTTGATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-2498s1c1
Sequence:CCGGCCCTGAACCAAGATCACTGAACTCGAGTTCAGTGATCTTGGTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-932s1c1
Sequence:CCGGCCTGGATGACTTGTTCAGCTTCTCGAGAAGCTGAACAAGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005224.1-1960s1c1
Sequence:CCGGCCTCAAATAACTCGTTGCCTTCTCGAGAAGGCAACGAGTTATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2466s21c1
Sequence:CCGGCCGATCCTGTTTACCTCATACCTCGAGGTATGAGGTAAACAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005224.2-1918s21c1
Sequence:CCGGCAACCTCTGCTCCCAACAAAGCTCGAGCTTTGTTGGGAGCAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-959s21c1
Sequence:CCGGGACTTACGAGGAGCAGTTTAACTCGAGTTAAACTGCTCCTCGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-2040s21c1
Sequence:CCGGTCCACATCTACCTCAAATAACCTCGAGGTTATTTGAGGTAGATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005224.2-650s21c1
Sequence:CCGGCGAGGACATGAAGCCCAAATGCTCGAGCATTTGGGCTTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks