EMAIL THIS PAGE TO A FRIEND

ARID3B

AT rich interactive domain 3B (BRIGHT-like)

Synonyms: BDP DRIL2
UniProtKB ID: Q8IVW6, O95443, Q59HC9, Q6P9C9
Gene ID:
Human(10620) Summary: This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA-binding proteins. The encoded protein is homologous with two proteins that bind to the retinoblastoma gene product, and also with the mouse Bright and Drosophila dead ringer proteins. A pseudogene on chromosome 1p31 exists for this gene. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
Mouse(56380) AT rich interactive domain 3B (BRIGHT-like)
Rat(367092) AT rich interactive domain 3B (Bright like)
sheep(101110365) AT rich interactive domain 3B (BRIGHT-like)
naked mole-rat(101701755) AT rich interactive domain 3B (BRIGHT-like)
domestic guinea pig(100725441) AT rich interactive domain 3B (BRIGHT-like)
Zebrafish(571249) AT rich interactive domain 3B (Bright like)
cow(532938) AT rich interactive domain 3B (BRIGHT-like)
Horse(100051675) AT rich interactive domain 3B (BRIGHT-like)
chicken(100859297) AT rich interactive domain 3B (BRIGHT-like)
dog(487646) AT rich interactive domain 3B (BRIGHT-like)
domestic cat(101084110) AT rich interactive domain 3B (BRIGHT-like)
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006465 Rosetta Predictions human pricing
NM_001109001 Rosetta Predictions rat pricing
NM_019689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078098 predicted 1013
2 SASI_Hs01_00078100 predicted 1056
3 SASI_Hs01_00078101 predicted 652
4 SASI_Hs01_00078102 predicted 788
5 SASI_Hs02_00341623 predicted 2187
6 SASI_Hs01_00078104 predicted 2088
7 SASI_Hs01_00078105 predicted 717
8 SASI_Hs01_00078106 predicted 641
9 SASI_Hs01_00078107 predicted 860
10 SASI_Hs02_00341624 predicted 855
11 SASI_Hs01_00078099 predicted 2099
12 SASI_Hs01_00078103 predicted 1990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244194 predicted 785
2 SASI_Rn02_00244195 predicted 574
3 SASI_Rn02_00244196 predicted 293
4 SASI_Rn02_00244197 predicted 2020
5 SASI_Rn02_00244198 predicted 2013
6 SASI_Rn02_00244199 predicted 1928
7 SASI_Rn02_00244200 predicted 644
8 SASI_Rn02_00244201 predicted 2224
9 SASI_Rn02_00244202 predicted 371
10 SASI_Rn02_00244203 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103482 predicted 2041
2 SASI_Mm01_00103483 predicted 815
3 SASI_Mm01_00103484 predicted 504
4 SASI_Mm01_00103485 predicted 2054
5 SASI_Mm01_00103486 predicted 526
6 SASI_Mm01_00103487 predicted 1960
7 SASI_Mm01_00103488 predicted 423
8 SASI_Mm01_00103489 predicted 669
9 SASI_Mm01_00103490 predicted 492
10 SASI_Mm02_00324773 predicted 2217
11 SASI_Mm01_00103491 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006465
VALIDATED
ARID3B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3B (BRIGHT-like)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2189s21c1
Sequence:CCGGAGTGTATCGACAATCTGTCAGCTCGAGCTGACAGATTGTCGATACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-1933s21c1
Sequence:CCGGGAAGTTGATGCACAGAATTTACTCGAGTAAATTCTGTGCATCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2093s21c1
Sequence:CCGGGTTGTCCAATCAGGGATTGTCCTCGAGGACAATCCCTGATTGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-3233s1c1
Sequence:CCGGCCAGGGTATGAGGAGATGAATCTCGAGATTCATCTCCTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1060s1c1
Sequence:CCGGGTATGCCTATGAGTGTGAGAACTCGAGTTCTCACACTCATAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-2394s1c1
Sequence:CCGGCCTCAAACACAAGTCTTGAATCTCGAGATTCAAGACTTGTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-605s1c1
Sequence:CCGGCCACATGGACAACAAGCTAAACTCGAGTTTAGCTTGTTGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006465.1-631s1c1
Sequence:CCGGCCATACCAAAGATGCTTCCAACTCGAGTTGGAAGCATCTTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1626s1c1
Sequence:CCGGCGAGTAGCATTGGGAGCATTACTCGAGTAATGCTCCCAATGCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-276s1c1
Sequence:CCGGCCCAGTTCTTGTATGCCCAAACTCGAGTTTGGGCATACAAGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-800s1c1
Sequence:CCGGGACGGTGATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-569s1c1
Sequence:CCGGCCCATGTCCAATCTACTTCCACTCGAGTGGAAGTAGATTGGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006465
VALIDATED
ARID3B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3B (BRIGHT-like)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2189s21c1
Sequence:CCGGAGTGTATCGACAATCTGTCAGCTCGAGCTGACAGATTGTCGATACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-1933s21c1
Sequence:CCGGGAAGTTGATGCACAGAATTTACTCGAGTAAATTCTGTGCATCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2093s21c1
Sequence:CCGGGTTGTCCAATCAGGGATTGTCCTCGAGGACAATCCCTGATTGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-3233s1c1
Sequence:CCGGCCAGGGTATGAGGAGATGAATCTCGAGATTCATCTCCTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1060s1c1
Sequence:CCGGGTATGCCTATGAGTGTGAGAACTCGAGTTCTCACACTCATAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-2394s1c1
Sequence:CCGGCCTCAAACACAAGTCTTGAATCTCGAGATTCAAGACTTGTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-605s1c1
Sequence:CCGGCCACATGGACAACAAGCTAAACTCGAGTTTAGCTTGTTGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006465.1-631s1c1
Sequence:CCGGCCATACCAAAGATGCTTCCAACTCGAGTTGGAAGCATCTTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1626s1c1
Sequence:CCGGCGAGTAGCATTGGGAGCATTACTCGAGTAATGCTCCCAATGCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-276s1c1
Sequence:CCGGCCCAGTTCTTGTATGCCCAAACTCGAGTTTGGGCATACAAGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-800s1c1
Sequence:CCGGGACGGTGATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-569s1c1
Sequence:CCGGCCCATGTCCAATCTACTTCCACTCGAGTGGAAGTAGATTGGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006465
VALIDATED
ARID3B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3B (BRIGHT-like)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2189s21c1
Sequence:CCGGAGTGTATCGACAATCTGTCAGCTCGAGCTGACAGATTGTCGATACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-1933s21c1
Sequence:CCGGGAAGTTGATGCACAGAATTTACTCGAGTAAATTCTGTGCATCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006465.2-2093s21c1
Sequence:CCGGGTTGTCCAATCAGGGATTGTCCTCGAGGACAATCCCTGATTGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-3233s1c1
Sequence:CCGGCCAGGGTATGAGGAGATGAATCTCGAGATTCATCTCCTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1060s1c1
Sequence:CCGGGTATGCCTATGAGTGTGAGAACTCGAGTTCTCACACTCATAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006465.1-2394s1c1
Sequence:CCGGCCTCAAACACAAGTCTTGAATCTCGAGATTCAAGACTTGTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-605s1c1
Sequence:CCGGCCACATGGACAACAAGCTAAACTCGAGTTTAGCTTGTTGTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006465.1-631s1c1
Sequence:CCGGCCATACCAAAGATGCTTCCAACTCGAGTTGGAAGCATCTTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-1626s1c1
Sequence:CCGGCGAGTAGCATTGGGAGCATTACTCGAGTAATGCTCCCAATGCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006465.1-276s1c1
Sequence:CCGGCCCAGTTCTTGTATGCCCAAACTCGAGTTTGGGCATACAAGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-800s1c1
Sequence:CCGGGACGGTGATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006465.1-569s1c1
Sequence:CCGGCCCATGTCCAATCTACTTCCACTCGAGTGGAAGTAGATTGGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019689
ARID3B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3B (BRIGHT-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1576s1c1
Sequence:CCGGGCATCAATATGTCTGTGGATACTCGAGTATCCACAGACATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-944s1c1
Sequence:CCGGCCTCAGGACTCAGTACATGAACTCGAGTTCATGTACTGAGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1250s1c1
Sequence:CCGGCCCGGCATCTACTCTCAGGAACTCGAGTTCCTGAGAGTAGATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-418s1c1
Sequence:CCGGCCCAGGCTGCTTCCAAATATTCTCGAGAATATTTGGAAGCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-516s1c1
Sequence:CCGGCCACAGGGACAACAAACTAAACTCGAGTTTAGTTTGTTGTCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019689
ARID3B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3B (BRIGHT-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1576s1c1
Sequence:CCGGGCATCAATATGTCTGTGGATACTCGAGTATCCACAGACATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-944s1c1
Sequence:CCGGCCTCAGGACTCAGTACATGAACTCGAGTTCATGTACTGAGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1250s1c1
Sequence:CCGGCCCGGCATCTACTCTCAGGAACTCGAGTTCCTGAGAGTAGATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-418s1c1
Sequence:CCGGCCCAGGCTGCTTCCAAATATTCTCGAGAATATTTGGAAGCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-516s1c1
Sequence:CCGGCCACAGGGACAACAAACTAAACTCGAGTTTAGTTTGTTGTCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019689
ARID3B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3B (BRIGHT-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1576s1c1
Sequence:CCGGGCATCAATATGTCTGTGGATACTCGAGTATCCACAGACATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-944s1c1
Sequence:CCGGCCTCAGGACTCAGTACATGAACTCGAGTTCATGTACTGAGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-1250s1c1
Sequence:CCGGCCCGGCATCTACTCTCAGGAACTCGAGTTCCTGAGAGTAGATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-418s1c1
Sequence:CCGGCCCAGGCTGCTTCCAAATATTCTCGAGAATATTTGGAAGCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019689.1-516s1c1
Sequence:CCGGCCACAGGGACAACAAACTAAACTCGAGTTTAGTTTGTTGTCCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks