EMAIL THIS PAGE TO A FRIEND

ARID3C

AT rich interactive domain 3C (BRIGHT-like)

58 Gene Product Result for
UniProtKB ID: A6NKF2
Gene ID:
Human(138715) Summary: This gene is a member of the ARID (AT-rich interaction domain) family of proteins. The ARID domain is a helix-turn-helix motif-based DNA-binding domain. ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
Mouse(550619) AT rich interactive domain 3C (BRIGHT-like)
Rat(502946) AT rich interactive domain 3C (BRIGHT-like)
cow(522142) AT rich interactive domain 3C (BRIGHT-like)
domestic cat(101084658) AT rich interactive domain 3C (BRIGHT-like)
dog(611843) AT rich interactive domain 3C (BRIGHT-like)
domestic guinea pig(100722904) AT rich interactive domain 3C (BRIGHT-like)
naked mole-rat(101708010) AT rich interactive domain 3C (BRIGHT-like)
sheep(101116967) AT rich interactive domain 3C (BRIGHT-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304197 ANTI-ARID3C (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV50384 Anti-ARID3C antibody produced in rabbit affinity isolated antibody rat, canine, mouse, human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142031 MISSION® esiRNA esiRNA human ARID3C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017363 Rosetta Predictions human pricing
XM_001068924 Rosetta Predictions rat pricing
XM_578450 Rosetta Predictions rat pricing
NM_001017362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154754 predicted 836
2 SASI_Hs01_00154755 predicted 836
3 SASI_Hs01_00154756 predicted 837
4 SASI_Hs02_00306698 predicted 480
5 SASI_Hs01_00154757 predicted 869
6 SASI_Hs01_00154758 predicted 486
7 SASI_Hs01_00154759 predicted 479
8 SASI_Hs01_00154760 predicted 488
9 SASI_Hs01_00154761 predicted 587
10 SASI_Hs01_00154762 predicted 495
11 SASI_Hs01_00154763 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326314 predicted 1234
2 SASI_Rn02_00326315 predicted 606
3 SASI_Rn02_00326316 predicted 863
4 SASI_Rn02_00326317 predicted 853
5 SASI_Rn02_00326318 predicted 897
6 SASI_Rn02_00326319 predicted 1302
7 SASI_Rn02_00326320 predicted 659
8 SASI_Rn02_00326321 predicted 840
9 SASI_Rn02_00326322 predicted 1071
10 SASI_Rn02_00326323 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407888 predicted 1227
2 SASI_Rn02_00407889 predicted 605
3 SASI_Rn02_00407890 predicted 864
4 SASI_Rn02_00407891 predicted 852
5 SASI_Rn02_00407892 predicted 900
6 SASI_Rn02_00407893 predicted 1309
7 SASI_Rn02_00407894 predicted 662
8 SASI_Rn02_00407895 predicted 837
9 SASI_Rn02_00407896 predicted 1067
10 SASI_Rn02_00407897 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287473 predicted 1208
2 SASI_Mm02_00287474 predicted 1066
3 SASI_Mm02_00287475 predicted 1492
4 SASI_Mm01_00052088 predicted 475
5 SASI_Mm02_00287476 predicted 1509
6 SASI_Mm01_00052091 predicted 507
7 SASI_Mm02_00287477 predicted 1490
8 SASI_Mm02_00287478 predicted 1485
9 SASI_Mm02_00287479 predicted 1345
10 SASI_Mm02_00287480 predicted 1361
11 SASI_Mm01_00052087 predicted 543
12 SASI_Mm01_00052089 predicted 286
13 SASI_Mm01_00052090 predicted 882
14 SASI_Mm01_00052092 predicted 917
15 SASI_Mm01_00052093 predicted 426
16 SASI_Mm01_00052094 predicted 593
17 SASI_Mm01_00052095 predicted 804
18 SASI_Mm01_00052096 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017363
ARID3C MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3C (BRIGHT-like)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-304s1c1
Sequence:CCGGGAACAATTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-853s1c1
Sequence:CCGGCCTATTAAGAAAGAGGAGAGTCTCGAGACTCTCCTCTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-352s1c1
Sequence:CCGGGAATTTCTGGATGACCTGTTTCTCGAGAAACAGGTCATCCAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-481s1c1
Sequence:CCGGGTGGAAGTCATCAACCGCAAACTCGAGTTTGCGGTTGATGACTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-154s1c1
Sequence:CCGGGAAGAGGAAGATGCTGAAGAACTCGAGTTCTTCAGCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-684s21c1
Sequence:CCGGTTACACCGCTACTCCGCTCTTCTCGAGAAGAGCGGAGTAGCGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-927s21c1
Sequence:CCGGACGGGAGAAATTGGCACCAGACTCGAGTCTGGTGCCAATTTCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017363
ARID3C MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3C (BRIGHT-like)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-304s1c1
Sequence:CCGGGAACAATTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-853s1c1
Sequence:CCGGCCTATTAAGAAAGAGGAGAGTCTCGAGACTCTCCTCTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-352s1c1
Sequence:CCGGGAATTTCTGGATGACCTGTTTCTCGAGAAACAGGTCATCCAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-481s1c1
Sequence:CCGGGTGGAAGTCATCAACCGCAAACTCGAGTTTGCGGTTGATGACTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-154s1c1
Sequence:CCGGGAAGAGGAAGATGCTGAAGAACTCGAGTTCTTCAGCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-684s21c1
Sequence:CCGGTTACACCGCTACTCCGCTCTTCTCGAGAAGAGCGGAGTAGCGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-927s21c1
Sequence:CCGGACGGGAGAAATTGGCACCAGACTCGAGTCTGGTGCCAATTTCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017363
ARID3C MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3C (BRIGHT-like)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-304s1c1
Sequence:CCGGGAACAATTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-853s1c1
Sequence:CCGGCCTATTAAGAAAGAGGAGAGTCTCGAGACTCTCCTCTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-352s1c1
Sequence:CCGGGAATTTCTGGATGACCTGTTTCTCGAGAAACAGGTCATCCAGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-481s1c1
Sequence:CCGGGTGGAAGTCATCAACCGCAAACTCGAGTTTGCGGTTGATGACTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017363.1-154s1c1
Sequence:CCGGGAAGAGGAAGATGCTGAAGAACTCGAGTTCTTCAGCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-684s21c1
Sequence:CCGGTTACACCGCTACTCCGCTCTTCTCGAGAAGAGCGGAGTAGCGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017363.1-927s21c1
Sequence:CCGGACGGGAGAAATTGGCACCAGACTCGAGTCTGGTGCCAATTTCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017362
ARID3C MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 3C (BRIGHT-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-266s1c1
Sequence:CCGGGAATCCAACCACATGAGTGGACTCGAGTCCACTCATGTGGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-570s1c1
Sequence:CCGGCATGAAGTATTTGTACCCATACTCGAGTATGGGTACAAATACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-1074s1c1
Sequence:CCGGCAGTGGCATCAGCAGTATCAACTCGAGTTGATACTGCTGATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-555s1c1
Sequence:CCGGGCTCCGTACACAGTACATGAACTCGAGTTCATGTACTGTGTACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-295s1c1
Sequence:CCGGGAACAGTTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017362
ARID3C MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 3C (BRIGHT-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-266s1c1
Sequence:CCGGGAATCCAACCACATGAGTGGACTCGAGTCCACTCATGTGGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-570s1c1
Sequence:CCGGCATGAAGTATTTGTACCCATACTCGAGTATGGGTACAAATACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-1074s1c1
Sequence:CCGGCAGTGGCATCAGCAGTATCAACTCGAGTTGATACTGCTGATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-555s1c1
Sequence:CCGGGCTCCGTACACAGTACATGAACTCGAGTTCATGTACTGTGTACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-295s1c1
Sequence:CCGGGAACAGTTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017362
ARID3C MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 3C (BRIGHT-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-266s1c1
Sequence:CCGGGAATCCAACCACATGAGTGGACTCGAGTCCACTCATGTGGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-570s1c1
Sequence:CCGGCATGAAGTATTTGTACCCATACTCGAGTATGGGTACAAATACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-1074s1c1
Sequence:CCGGCAGTGGCATCAGCAGTATCAACTCGAGTTGATACTGCTGATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-555s1c1
Sequence:CCGGGCTCCGTACACAGTACATGAACTCGAGTTCATGTACTGTGTACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017362.1-295s1c1
Sequence:CCGGGAACAGTTCAAGCAGCTGTATCTCGAGATACAGCTGCTTGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks