EMAIL THIS PAGE TO A FRIEND

ARID4B

AT rich interactive domain 4B (RBP1-like)

206 Gene Product Result for
Synonyms: BCAA BRCAA1 RBBP1L1 RBP1L1 SAP180
Gene ID:
Human(51742) Summary: This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
Mouse(94246) AT rich interactive domain 4B (RBP1-like)
Rat(84481) AT rich interactive domain 4B (Rbp1 like)
chicken(425840) AT rich interactive domain 4B (RBP1-like)
dog(488959) AT rich interactive domain 4B (RBP1-like)
cow(534612) AT rich interactive domain 4B (RBP1-like)
Horse(100058766) AT rich interactive domain 4B (RBP1-like)
domestic cat(101086256) AT rich interactive domain 4B (RBP1-like)
domestic guinea pig(100729934) AT rich interactive domain 4B (RBP1-like)
naked mole-rat(101699242) AT rich interactive domain 4B (RBP1-like)
sheep(101116701) AT rich interactive domain 4B (RBP1-like)
Domestic Rabbit(100352525) AT rich interactive domain 4B (RBP1-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027333 Anti-ARID4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
B8561 Anti-BRCAA1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
PLA0247 Rabbit anti-ARID4B Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, chicken, human, dog, horse, turkey, rat, primate, mouse, pig, rabbit
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016374 Rosetta Predictions human pricing
NM_031371 Rosetta Predictions human pricing
NM_053421 Rosetta Predictions rat pricing
NM_194262 Rosetta Predictions mouse pricing
NM_198122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134230 predicted 927
2 SASI_Hs02_00349366 predicted 4110
3 SASI_Hs01_00134231 predicted 3657
4 SASI_Hs01_00134233 predicted 2662
5 SASI_Hs01_00134234 predicted 704
6 SASI_Hs02_00349367 predicted 2919
7 SASI_Hs01_00134236 predicted 3422
8 SASI_Hs01_00134237 predicted 1010
9 SASI_Hs01_00134238 predicted 1078
10 SASI_Hs01_00134239 predicted 1683
11 SASI_Hs01_00134232 predicted 994
12 SASI_Hs01_00134235 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128528 predicted 929
2 SASI_Hs02_00358771 predicted 3858
3 SASI_Hs01_00128529 predicted 3393
4 SASI_Hs01_00128531 predicted 2412
5 SASI_Hs01_00128532 predicted 703
6 SASI_Hs02_00358772 predicted 2664
7 SASI_Hs01_00128534 predicted 3164
8 SASI_Hs01_00128535 predicted 1008
9 SASI_Hs01_00128536 predicted 1081
10 SASI_Hs01_00128537 predicted 1686
11 SASI_Hs01_00128530 predicted 1004
12 SASI_Hs01_00128533 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105713 predicted 1034
2 SASI_Rn02_00265963 predicted 3245
3 SASI_Rn01_00105714 predicted 2075
4 SASI_Rn01_00105716 predicted 3137
5 SASI_Rn01_00105717 predicted 336
6 SASI_Rn01_00105718 predicted 1217
7 SASI_Rn01_00105719 predicted 385
8 SASI_Rn01_00105722 predicted 820
9 SASI_Rn02_00265964 predicted 3538
10 SASI_Rn02_00265965 predicted 3051
11 SASI_Rn01_00105715 predicted 265
12 SASI_Rn01_00105720 predicted 2883
13 SASI_Rn01_00105721 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086061 predicted 4094
2 SASI_Mm02_00350597 predicted 3470
3 SASI_Mm01_00086062 predicted 3648
4 SASI_Mm01_00086063 predicted 2450
5 SASI_Mm01_00086064 predicted 718
6 SASI_Mm01_00086065 predicted 585
7 SASI_Mm01_00086066 predicted 3296
8 SASI_Mm01_00086068 predicted 639
9 SASI_Mm01_00086069 predicted 2365
10 SASI_Mm01_00086070 predicted 4215
11 SASI_Mm01_00086067 predicted 3048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078885 predicted 3838
2 SASI_Mm02_00350868 predicted 3211
3 SASI_Mm01_00078886 predicted 3391
4 SASI_Mm01_00078887 predicted 2189
5 SASI_Mm01_00078888 predicted 720
6 SASI_Mm01_00078889 predicted 592
7 SASI_Mm01_00078890 predicted 3030
8 SASI_Mm01_00078892 predicted 636
9 SASI_Mm01_00078893 predicted 2104
10 SASI_Mm01_00078894 predicted 3952
11 SASI_Mm01_00078891 predicted 2781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016374
VALIDATED
ARID4B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 4B (RBP1-like)
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-4160s1c1
Sequence:CCGGCGCATCACAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-504s1c1
Sequence:CCGGGCACTGATGTGAGTGCTAAATCTCGAGATTTAGCACTCACATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-983s1c1
Sequence:CCGGCTAGGCAAAGTTGTATGTGTACTCGAGTACACATACAACTTTGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-3871s1c1
Sequence:CCGGCCATAAAGCAACAGTGGTAAACTCGAGTTTACCACTGTTGCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-1442s1c1
Sequence:CCGGCCTATTAACAAACGACCTGTACTCGAGTACAGGTCGTTTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016374.4-5756s1c1
Sequence:CCGGCGTGTCAGAATCCTTTACATTCTCGAGAATGTAAAGGATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-2949s1c1
Sequence:CCGGGCAATACAGAAGAGTGTCTAACTCGAGTTAGACACTCTTCTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-1994s1c1
Sequence:CCGGGTAGATGAATCCCTCAACATACTCGAGTATGTTGAGGGATTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2700s21c1
Sequence:CCGGGGAATCTAAGATTGATCATTTCTCGAGAAATGATCAATCTTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1491s21c1
Sequence:CCGGTGTACTTGGATATCGAAATTTCTCGAGAAATTTCGATATCCAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4724s21c1
Sequence:CCGGCAATACAGTAAGCATAGTTAACTCGAGTTAACTATGCTTACTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1461s21c1
Sequence:CCGGAGATAGAGGTACACCTATTAACTCGAGTTAATAGGTGTACCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-4272s21c1
Sequence:CCGGTCGGAGGAGAAAGCGTTTAAACTCGAGTTTAAACGCTTTCTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2864s21c1
Sequence:CCGGTATCCGAAGATACTGATTATGCTCGAGCATAATCAGTATCTTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2564s21c1
Sequence:CCGGACTCTGATACTGCTCATATTACTCGAGTAATATGAGCAGTATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4921s21c1
Sequence:CCGGAGTCAAGCACATGTAATAAATCTCGAGATTTATTACATGTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2027s21c1
Sequence:CCGGTAGATGAATCCCTCAACATAACTCGAGTTATGTTGAGGGATTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4896s21c1
Sequence:CCGGACCTTAGGGTGGCTTTAATTGCTCGAGCAATTAAAGCCACCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016374
VALIDATED
ARID4B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 4B (RBP1-like)
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-4160s1c1
Sequence:CCGGCGCATCACAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-504s1c1
Sequence:CCGGGCACTGATGTGAGTGCTAAATCTCGAGATTTAGCACTCACATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-983s1c1
Sequence:CCGGCTAGGCAAAGTTGTATGTGTACTCGAGTACACATACAACTTTGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-3871s1c1
Sequence:CCGGCCATAAAGCAACAGTGGTAAACTCGAGTTTACCACTGTTGCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-1442s1c1
Sequence:CCGGCCTATTAACAAACGACCTGTACTCGAGTACAGGTCGTTTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016374.4-5756s1c1
Sequence:CCGGCGTGTCAGAATCCTTTACATTCTCGAGAATGTAAAGGATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-2949s1c1
Sequence:CCGGGCAATACAGAAGAGTGTCTAACTCGAGTTAGACACTCTTCTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-1994s1c1
Sequence:CCGGGTAGATGAATCCCTCAACATACTCGAGTATGTTGAGGGATTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2700s21c1
Sequence:CCGGGGAATCTAAGATTGATCATTTCTCGAGAAATGATCAATCTTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1491s21c1
Sequence:CCGGTGTACTTGGATATCGAAATTTCTCGAGAAATTTCGATATCCAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4724s21c1
Sequence:CCGGCAATACAGTAAGCATAGTTAACTCGAGTTAACTATGCTTACTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1461s21c1
Sequence:CCGGAGATAGAGGTACACCTATTAACTCGAGTTAATAGGTGTACCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-4272s21c1
Sequence:CCGGTCGGAGGAGAAAGCGTTTAAACTCGAGTTTAAACGCTTTCTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2864s21c1
Sequence:CCGGTATCCGAAGATACTGATTATGCTCGAGCATAATCAGTATCTTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2564s21c1
Sequence:CCGGACTCTGATACTGCTCATATTACTCGAGTAATATGAGCAGTATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4921s21c1
Sequence:CCGGAGTCAAGCACATGTAATAAATCTCGAGATTTATTACATGTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2027s21c1
Sequence:CCGGTAGATGAATCCCTCAACATAACTCGAGTTATGTTGAGGGATTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4896s21c1
Sequence:CCGGACCTTAGGGTGGCTTTAATTGCTCGAGCAATTAAAGCCACCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016374
VALIDATED
ARID4B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 4B (RBP1-like)
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-4160s1c1
Sequence:CCGGCGCATCACAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-504s1c1
Sequence:CCGGGCACTGATGTGAGTGCTAAATCTCGAGATTTAGCACTCACATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-983s1c1
Sequence:CCGGCTAGGCAAAGTTGTATGTGTACTCGAGTACACATACAACTTTGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-3871s1c1
Sequence:CCGGCCATAAAGCAACAGTGGTAAACTCGAGTTTACCACTGTTGCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-1442s1c1
Sequence:CCGGCCTATTAACAAACGACCTGTACTCGAGTACAGGTCGTTTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016374.4-5756s1c1
Sequence:CCGGCGTGTCAGAATCCTTTACATTCTCGAGAATGTAAAGGATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016374.4-2949s1c1
Sequence:CCGGGCAATACAGAAGAGTGTCTAACTCGAGTTAGACACTCTTCTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016374.4-1994s1c1
Sequence:CCGGGTAGATGAATCCCTCAACATACTCGAGTATGTTGAGGGATTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2700s21c1
Sequence:CCGGGGAATCTAAGATTGATCATTTCTCGAGAAATGATCAATCTTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1491s21c1
Sequence:CCGGTGTACTTGGATATCGAAATTTCTCGAGAAATTTCGATATCCAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4724s21c1
Sequence:CCGGCAATACAGTAAGCATAGTTAACTCGAGTTAACTATGCTTACTGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-1461s21c1
Sequence:CCGGAGATAGAGGTACACCTATTAACTCGAGTTAATAGGTGTACCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-4272s21c1
Sequence:CCGGTCGGAGGAGAAAGCGTTTAAACTCGAGTTTAAACGCTTTCTCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2864s21c1
Sequence:CCGGTATCCGAAGATACTGATTATGCTCGAGCATAATCAGTATCTTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2564s21c1
Sequence:CCGGACTCTGATACTGCTCATATTACTCGAGTAATATGAGCAGTATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4921s21c1
Sequence:CCGGAGTCAAGCACATGTAATAAATCTCGAGATTTATTACATGTGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016374.5-2027s21c1
Sequence:CCGGTAGATGAATCCCTCAACATAACTCGAGTTATGTTGAGGGATTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016374.5-4896s21c1
Sequence:CCGGACCTTAGGGTGGCTTTAATTGCTCGAGCAATTAAAGCCACCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194262
VALIDATED
ARID4B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 4B (RBP1-like)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194262.1-5028s1c1
Sequence:CCGGGCCAGTTCAAAGTGTATATTTCTCGAGAAATATACACTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-3990s1c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194262.1-3382s1c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-2521s1c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-1006s1c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3990s21c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-2521s21c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3382s21c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-1006s21c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194262
VALIDATED
ARID4B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 4B (RBP1-like)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194262.1-5028s1c1
Sequence:CCGGGCCAGTTCAAAGTGTATATTTCTCGAGAAATATACACTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-3990s1c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194262.1-3382s1c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-2521s1c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-1006s1c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3990s21c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-2521s21c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3382s21c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-1006s21c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194262
VALIDATED
ARID4B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 4B (RBP1-like)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194262.1-5028s1c1
Sequence:CCGGGCCAGTTCAAAGTGTATATTTCTCGAGAAATATACACTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-3990s1c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194262.1-3382s1c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-2521s1c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194262.1-1006s1c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3990s21c1
Sequence:CCGGCGTATCTCAATTCTTCAAGAACTCGAGTTCTTGAAGAATTGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-2521s21c1
Sequence:CCGGGCAGAAATGAACTGATTTCAACTCGAGTTGAAATCAGTTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-3382s21c1
Sequence:CCGGCGCCTTCTTCAGTCACTATAACTCGAGTTATAGTGACTGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194262.1-1006s21c1
Sequence:CCGGCGAAGCCTGATGCTGTATTAACTCGAGTTAATACAGCATCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks