EMAIL THIS PAGE TO A FRIEND

ARID5A

AT rich interactive domain 5A (MRF1-like)

64 Gene Product Result for
Synonyms: MRF-1 MRF1 RP11-363D14
UniProtKB ID: Q03989, Q6NX37
Gene ID:
Human(10865) Summary: Members of the ARID protein family, including ARID5A, have diverse functions but all appear to play important roles in development, tissue-specific gene expression, and regulation of cell growth (Patsialou et al., 2005 [PubMed 15640446]
Mouse(214855) AT rich interactive domain 5A (MRF1-like)
Rat(316327) AT rich interactive domain 5A (Mrf1 like)
Zebrafish(100462698) AT rich interactive domain 5A (MRF1-like)
chicken(101665604) AT rich interactive domain 5A (MRF1-like)
cow(524118) AT rich interactive domain 5A (MRF1-like)
domestic cat(101093347) AT rich interactive domain 5A (MRF1-like)
dog(483050) AT rich interactive domain 5A (MRF1-like)
chicken(431046) AT rich interactive domain 5A (MRF1-like)
chicken(101749459) AT rich interactive domain 5A (MRF1-like)
sheep(101114695) AT rich interactive domain 5A (MRF1-like)
naked mole-rat(101706713) AT rich interactive domain 5A (MRF1-like)
domestic guinea pig(100714859) AT rich interactive domain 5A (MRF1-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006673 Rosetta Predictions human pricing
NM_212481 Rosetta Predictions human pricing
NM_001034934 Rosetta Predictions rat pricing
NM_145996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159413 predicted 680
2 SASI_Hs01_00159414 predicted 630
3 SASI_Hs01_00159415 predicted 526
4 SASI_Hs01_00159416 predicted 214
5 SASI_Hs01_00159417 predicted 177
6 SASI_Hs01_00159418 predicted 1199
7 SASI_Hs01_00159419 predicted 1948
8 SASI_Hs01_00159420 predicted 1757
9 SASI_Hs01_00159421 predicted 1174
10 SASI_Hs01_00159422 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374207 predicted 1174
2 SASI_Hs01_00118149 predicted 1171
3 SASI_Hs01_00118150 predicted 817
4 SASI_Hs01_00118151 predicted 1891
5 SASI_Hs01_00118152 predicted 1306
6 SASI_Hs01_00118153 predicted 1175
7 SASI_Hs02_00374208 predicted 1890
8 SASI_Hs01_00118154 predicted 1921
9 SASI_Hs01_00118155 predicted 764
10 SASI_Hs01_00118156 predicted 1784
11 SASI_Hs01_00118148 predicted 1339
12 SASI_Hs01_00118157 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098962 predicted 1742
2 SASI_Rn01_00098963 predicted 1816
3 SASI_Rn01_00098964 predicted 1442
4 SASI_Rn01_00098966 predicted 413
5 SASI_Rn01_00098967 predicted 935
6 SASI_Rn01_00098968 predicted 1845
7 SASI_Rn01_00098969 predicted 1741
8 SASI_Rn01_00098970 predicted 880
9 SASI_Rn01_00098971 predicted 658
10 SASI_Rn02_00204118 predicted 1148
11 SASI_Rn01_00098965 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341523 predicted 221
2 SASI_Mm02_00341524 predicted 1857
3 SASI_Mm02_00341525 predicted 353
4 SASI_Mm02_00341526 predicted 1208
5 SASI_Mm02_00341527 predicted 541
6 SASI_Mm02_00341528 predicted 531
7 SASI_Mm02_00341529 predicted 1411
8 SASI_Mm02_00341530 predicted 1860
9 SASI_Mm02_00341531 predicted 971
10 SASI_Mm02_00341532 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212481
ARID5A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 5A (MRF1-like)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-344s21c1
Sequence:CCGGCTCGGCTTCAAGCAGATTAACCTCGAGGTTAATCTGCTTGAAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1180s21c1
Sequence:CCGGGGACTTCTTCTCTAGACTTAACTCGAGTTAAGTCTAGAGAAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212481.1-1893s21c1
Sequence:CCGGCATGGTGTTGTGTACACTGTGCTCGAGCACAGTGTACACAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1283s21c1
Sequence:CCGGCGCCCTTCTGCGTTCCATAAACTCGAGTTTATGGAACGCAGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-827s21c1
Sequence:CCGGCTATCCAGCTTCTACTGCAAGCTCGAGCTTGCAGTAGAAGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212481
ARID5A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 5A (MRF1-like)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-344s21c1
Sequence:CCGGCTCGGCTTCAAGCAGATTAACCTCGAGGTTAATCTGCTTGAAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1180s21c1
Sequence:CCGGGGACTTCTTCTCTAGACTTAACTCGAGTTAAGTCTAGAGAAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212481.1-1893s21c1
Sequence:CCGGCATGGTGTTGTGTACACTGTGCTCGAGCACAGTGTACACAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1283s21c1
Sequence:CCGGCGCCCTTCTGCGTTCCATAAACTCGAGTTTATGGAACGCAGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-827s21c1
Sequence:CCGGCTATCCAGCTTCTACTGCAAGCTCGAGCTTGCAGTAGAAGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212481
ARID5A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 5A (MRF1-like)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-344s21c1
Sequence:CCGGCTCGGCTTCAAGCAGATTAACCTCGAGGTTAATCTGCTTGAAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1180s21c1
Sequence:CCGGGGACTTCTTCTCTAGACTTAACTCGAGTTAAGTCTAGAGAAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212481.1-1893s21c1
Sequence:CCGGCATGGTGTTGTGTACACTGTGCTCGAGCACAGTGTACACAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-1283s21c1
Sequence:CCGGCGCCCTTCTGCGTTCCATAAACTCGAGTTTATGGAACGCAGAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212481.1-827s21c1
Sequence:CCGGCTATCCAGCTTCTACTGCAAGCTCGAGCTTGCAGTAGAAGCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145996
ARID5A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 5A (MRF1-like)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1405s21c1
Sequence:CCGGGCTGCGGTGTCCTCTAAACTTCTCGAGAAGTTTAGAGGACACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1245s21c1
Sequence:CCGGTCGCTCATGGTGGCAAGAAACCTCGAGGTTTCTTGCCACCATGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145996.3-3784s21c1
Sequence:CCGGTCGTGACATTTGAGCTAATAACTCGAGTTATTAGCTCAAATGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-216s21c1
Sequence:CCGGGCCTCTGGAAGAACGTGTATGCTCGAGCATACACGTTCTTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1569s21c1
Sequence:CCGGATGACGCTGTCCTACGCAACACTCGAGTGTTGCGTAGGACAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-1083s1c1
Sequence:CCGGGCATTCCATAAAGGCAGCACACTCGAGTGTGCTGCCTTTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145996.2-3150s1c1
Sequence:CCGGGCCTGAGTATTCAGATGACAACTCGAGTTGTCATCTGAATACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-983s1c1
Sequence:CCGGCCTTAAAGACAGGGTGCTGTTCTCGAGAACAGCACCCTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-473s1c1
Sequence:CCGGGCCAGGAAAGACCAAATCAGACTCGAGTCTGATTTGGTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145996
ARID5A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 5A (MRF1-like)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1405s21c1
Sequence:CCGGGCTGCGGTGTCCTCTAAACTTCTCGAGAAGTTTAGAGGACACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1245s21c1
Sequence:CCGGTCGCTCATGGTGGCAAGAAACCTCGAGGTTTCTTGCCACCATGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145996.3-3784s21c1
Sequence:CCGGTCGTGACATTTGAGCTAATAACTCGAGTTATTAGCTCAAATGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-216s21c1
Sequence:CCGGGCCTCTGGAAGAACGTGTATGCTCGAGCATACACGTTCTTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1569s21c1
Sequence:CCGGATGACGCTGTCCTACGCAACACTCGAGTGTTGCGTAGGACAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-1083s1c1
Sequence:CCGGGCATTCCATAAAGGCAGCACACTCGAGTGTGCTGCCTTTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145996.2-3150s1c1
Sequence:CCGGGCCTGAGTATTCAGATGACAACTCGAGTTGTCATCTGAATACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-983s1c1
Sequence:CCGGCCTTAAAGACAGGGTGCTGTTCTCGAGAACAGCACCCTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-473s1c1
Sequence:CCGGGCCAGGAAAGACCAAATCAGACTCGAGTCTGATTTGGTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145996
ARID5A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 5A (MRF1-like)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1405s21c1
Sequence:CCGGGCTGCGGTGTCCTCTAAACTTCTCGAGAAGTTTAGAGGACACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1245s21c1
Sequence:CCGGTCGCTCATGGTGGCAAGAAACCTCGAGGTTTCTTGCCACCATGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145996.3-3784s21c1
Sequence:CCGGTCGTGACATTTGAGCTAATAACTCGAGTTATTAGCTCAAATGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-216s21c1
Sequence:CCGGGCCTCTGGAAGAACGTGTATGCTCGAGCATACACGTTCTTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145996.3-1569s21c1
Sequence:CCGGATGACGCTGTCCTACGCAACACTCGAGTGTTGCGTAGGACAGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-1083s1c1
Sequence:CCGGGCATTCCATAAAGGCAGCACACTCGAGTGTGCTGCCTTTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145996.2-3150s1c1
Sequence:CCGGGCCTGAGTATTCAGATGACAACTCGAGTTGTCATCTGAATACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-983s1c1
Sequence:CCGGCCTTAAAGACAGGGTGCTGTTCTCGAGAACAGCACCCTGTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145996.2-473s1c1
Sequence:CCGGGCCAGGAAAGACCAAATCAGACTCGAGTCTGATTTGGTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006673
VALIDATED
ARID5A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 5A (MRF1-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-1874s1c1
Sequence:CCGGCCTGGCACAAGTGAAGAAGAACTCGAGTTCTTCTTCACTTGTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-441s1c1
Sequence:CCGGGAAACAGTACAAGATGGCTAACTCGAGTTAGCCATCTTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006673.2-234s1c1
Sequence:CCGGGATCTACAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-231s1c1
Sequence:CCGGGAAGATCTACAAAGCAGTGGACTCGAGTCCACTGCTTTGTAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-228s1c1
Sequence:CCGGGTGGAAGATCTACAAAGCAGTCTCGAGACTGCTTTGTAGATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-218s1c1
Sequence:CCGGGAGTTAACCTGTGGAAGATCTCTCGAGAGATCTTCCACAGGTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-538s1c1
Sequence:CCGGCCAGGAAAGACCAAAGCAGATCTCGAGATCTGCTTTGGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006673.2-1878s1c1
Sequence:CCGGGCACAAGTGAAGAAGAAGGCACTCGAGTGCCTTCTTCTTCACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-435s1c1
Sequence:CCGGGCCCAGGAAACAGTACAAGATCTCGAGATCTTGTACTGTTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-237s1c1
Sequence:CCGGCTACAAAGCAGTGGAGAAGCTCTCGAGAGCTTCTCCACTGCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006673
VALIDATED
ARID5A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 5A (MRF1-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-1874s1c1
Sequence:CCGGCCTGGCACAAGTGAAGAAGAACTCGAGTTCTTCTTCACTTGTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-441s1c1
Sequence:CCGGGAAACAGTACAAGATGGCTAACTCGAGTTAGCCATCTTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006673.2-234s1c1
Sequence:CCGGGATCTACAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-231s1c1
Sequence:CCGGGAAGATCTACAAAGCAGTGGACTCGAGTCCACTGCTTTGTAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-228s1c1
Sequence:CCGGGTGGAAGATCTACAAAGCAGTCTCGAGACTGCTTTGTAGATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-218s1c1
Sequence:CCGGGAGTTAACCTGTGGAAGATCTCTCGAGAGATCTTCCACAGGTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-538s1c1
Sequence:CCGGCCAGGAAAGACCAAAGCAGATCTCGAGATCTGCTTTGGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006673.2-1878s1c1
Sequence:CCGGGCACAAGTGAAGAAGAAGGCACTCGAGTGCCTTCTTCTTCACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-435s1c1
Sequence:CCGGGCCCAGGAAACAGTACAAGATCTCGAGATCTTGTACTGTTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-237s1c1
Sequence:CCGGCTACAAAGCAGTGGAGAAGCTCTCGAGAGCTTCTCCACTGCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006673
VALIDATED
ARID5A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 5A (MRF1-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-1874s1c1
Sequence:CCGGCCTGGCACAAGTGAAGAAGAACTCGAGTTCTTCTTCACTTGTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-441s1c1
Sequence:CCGGGAAACAGTACAAGATGGCTAACTCGAGTTAGCCATCTTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006673.2-234s1c1
Sequence:CCGGGATCTACAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-231s1c1
Sequence:CCGGGAAGATCTACAAAGCAGTGGACTCGAGTCCACTGCTTTGTAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-228s1c1
Sequence:CCGGGTGGAAGATCTACAAAGCAGTCTCGAGACTGCTTTGTAGATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-218s1c1
Sequence:CCGGGAGTTAACCTGTGGAAGATCTCTCGAGAGATCTTCCACAGGTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006673.2-538s1c1
Sequence:CCGGCCAGGAAAGACCAAAGCAGATCTCGAGATCTGCTTTGGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006673.2-1878s1c1
Sequence:CCGGGCACAAGTGAAGAAGAAGGCACTCGAGTGCCTTCTTCTTCACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006673.2-435s1c1
Sequence:CCGGGCCCAGGAAACAGTACAAGATCTCGAGATCTTGTACTGTTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006673.2-237s1c1
Sequence:CCGGCTACAAAGCAGTGGAGAAGCTCTCGAGAGCTTCTCCACTGCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks