EMAIL THIS PAGE TO A FRIEND

ARID5B

AT rich interactive domain 5B (MRF1-like)

Synonyms: DESRT MRF-2 MRF2
Gene ID:
Human(84159) Summary: This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(71371) AT rich interactive domain 5B (MRF1-like)
Rat(309728) AT rich interactive domain 5B (Mrf1 like)
domestic guinea pig(100714779) AT rich interactive domain 5B (MRF1-like)
naked mole-rat(101714679) AT rich interactive domain 5B (MRF1-like)
sheep(101121742) AT rich interactive domain 5B (MRF1-like)
Domestic Rabbit(100352095) AT rich interactive domain 5B (MRF1-like)
chicken(423661) AT rich interactive domain 5B (MRF1-like)
cow(783538) AT rich interactive domain 5B (MRF1-like)
Horse(100072374) AT rich interactive domain 5B (MRF1-like)
dog(479217) AT rich interactive domain 5B (MRF1-like)
domestic cat(101081758) AT rich interactive domain 5B (MRF1-like)
292 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032199 Rosetta Predictions human pricing
NM_001107624 Rosetta Predictions rat pricing
NM_023598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184056 predicted 467
2 SASI_Hs02_00359493 predicted 2923
3 SASI_Hs02_00359494 predicted 605
4 SASI_Hs01_00184059 predicted 782
5 SASI_Hs01_00184060 predicted 809
6 SASI_Hs01_00184061 predicted 2579
7 SASI_Hs01_00184062 predicted 477
8 SASI_Hs01_00184063 predicted 1030
9 SASI_Hs01_00184065 predicted 3506
10 SASI_Hs02_00359495 predicted 2495
11 SASI_Hs01_00184057 predicted 824
12 SASI_Hs01_00184058 predicted 736
13 SASI_Hs01_00184064 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230665 predicted 1023
2 SASI_Rn02_00230666 predicted 819
3 SASI_Rn02_00230667 predicted 536
4 SASI_Rn02_00230668 predicted 2622
5 SASI_Rn02_00230669 predicted 728
6 SASI_Rn02_00230670 predicted 1708
7 SASI_Rn02_00230671 predicted 2465
8 SASI_Rn02_00230672 predicted 2551
9 SASI_Rn02_00230673 predicted 2626
10 SASI_Rn02_00230674 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062846 predicted 2745
2 SASI_Mm01_00062847 predicted 1036
3 SASI_Mm01_00062848 predicted 899
4 SASI_Mm02_00327205 predicted 2305
5 SASI_Mm01_00062850 predicted 1399
6 SASI_Mm01_00062852 predicted 1045
7 SASI_Mm02_00327206 predicted 336
8 SASI_Mm01_00062853 predicted 2649
9 SASI_Mm01_00062854 predicted 942
10 SASI_Mm02_00327207 predicted 997
11 SASI_Mm01_00062845 predicted 2642
12 SASI_Mm01_00062849 predicted 1213
13 SASI_Mm01_00062851 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032199
VALIDATED
ARID5B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 5B (MRF1-like)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032199.1-536s1c1
Sequence:CCGGCGAGGAAGAAACGAACGTGATCTCGAGATCACGTTCGTTTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-1039s1c1
Sequence:CCGGCGATAGAACGAATACCCTATTCTCGAGAATAGGGTATTCGTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-6882s1c1
Sequence:CCGGGCCTTCAAAGAGAACCATTTACTCGAGTAAATGGTTCTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-5515s1c1
Sequence:CCGGGCCGTGCATTTGTATTGAAATCTCGAGATTTCAATACAAATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-4662s1c1
Sequence:CCGGGCCGAATAACAACAGAGTCTACTCGAGTAGACTCTGTTGTTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-3522s1c1
Sequence:CCGGGCTGCTATAAATCCTCAAGCTCTCGAGAGCTTGAGGATTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-604s1c1
Sequence:CCGGGCATCCAGGATAAGCCATCTTCTCGAGAAGATGGCTTATCCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032199.1-3466s1c1
Sequence:CCGGCTACACCTGTAGGAAGTTCATCTCGAGATGAACTTCCTACAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-1880s1c1
Sequence:CCGGCATGGCAGATTACATTGCCAACTCGAGTTGGCAATGTAATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-747s21c1
Sequence:CCGGTGCGATGAGTTTGCGCCAAATCTCGAGATTTGGCGCAAACTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-1041s21c1
Sequence:CCGGATAGAACGAATACCCTATTTACTCGAGTAAATAGGGTATTCGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3513s21c1
Sequence:CCGGTACCCTTTAGCTGCTATAAATCTCGAGATTTATAGCAGCTAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-164s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3666s21c1
Sequence:CCGGATAGAGTTAGAAGTCAGTATTCTCGAGAATACTGACTTCTAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032199
VALIDATED
ARID5B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 5B (MRF1-like)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032199.1-536s1c1
Sequence:CCGGCGAGGAAGAAACGAACGTGATCTCGAGATCACGTTCGTTTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-1039s1c1
Sequence:CCGGCGATAGAACGAATACCCTATTCTCGAGAATAGGGTATTCGTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-6882s1c1
Sequence:CCGGGCCTTCAAAGAGAACCATTTACTCGAGTAAATGGTTCTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-5515s1c1
Sequence:CCGGGCCGTGCATTTGTATTGAAATCTCGAGATTTCAATACAAATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-4662s1c1
Sequence:CCGGGCCGAATAACAACAGAGTCTACTCGAGTAGACTCTGTTGTTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-3522s1c1
Sequence:CCGGGCTGCTATAAATCCTCAAGCTCTCGAGAGCTTGAGGATTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-604s1c1
Sequence:CCGGGCATCCAGGATAAGCCATCTTCTCGAGAAGATGGCTTATCCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032199.1-3466s1c1
Sequence:CCGGCTACACCTGTAGGAAGTTCATCTCGAGATGAACTTCCTACAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-1880s1c1
Sequence:CCGGCATGGCAGATTACATTGCCAACTCGAGTTGGCAATGTAATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-747s21c1
Sequence:CCGGTGCGATGAGTTTGCGCCAAATCTCGAGATTTGGCGCAAACTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-1041s21c1
Sequence:CCGGATAGAACGAATACCCTATTTACTCGAGTAAATAGGGTATTCGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3513s21c1
Sequence:CCGGTACCCTTTAGCTGCTATAAATCTCGAGATTTATAGCAGCTAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-164s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3666s21c1
Sequence:CCGGATAGAGTTAGAAGTCAGTATTCTCGAGAATACTGACTTCTAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032199
VALIDATED
ARID5B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 5B (MRF1-like)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032199.1-536s1c1
Sequence:CCGGCGAGGAAGAAACGAACGTGATCTCGAGATCACGTTCGTTTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-1039s1c1
Sequence:CCGGCGATAGAACGAATACCCTATTCTCGAGAATAGGGTATTCGTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032199.1-6882s1c1
Sequence:CCGGGCCTTCAAAGAGAACCATTTACTCGAGTAAATGGTTCTCTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-5515s1c1
Sequence:CCGGGCCGTGCATTTGTATTGAAATCTCGAGATTTCAATACAAATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032199.1-4662s1c1
Sequence:CCGGGCCGAATAACAACAGAGTCTACTCGAGTAGACTCTGTTGTTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-3522s1c1
Sequence:CCGGGCTGCTATAAATCCTCAAGCTCTCGAGAGCTTGAGGATTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-604s1c1
Sequence:CCGGGCATCCAGGATAAGCCATCTTCTCGAGAAGATGGCTTATCCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032199.1-3466s1c1
Sequence:CCGGCTACACCTGTAGGAAGTTCATCTCGAGATGAACTTCCTACAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032199.1-1880s1c1
Sequence:CCGGCATGGCAGATTACATTGCCAACTCGAGTTGGCAATGTAATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-747s21c1
Sequence:CCGGTGCGATGAGTTTGCGCCAAATCTCGAGATTTGGCGCAAACTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-1041s21c1
Sequence:CCGGATAGAACGAATACCCTATTTACTCGAGTAAATAGGGTATTCGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3513s21c1
Sequence:CCGGTACCCTTTAGCTGCTATAAATCTCGAGATTTATAGCAGCTAAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032199.1-164s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032199.1-3666s21c1
Sequence:CCGGATAGAGTTAGAAGTCAGTATTCTCGAGAATACTGACTTCTAACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023598
VALIDATED
ARID5B MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 5B (MRF1-like)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1632s1c1
Sequence:CCGGCCCAAGATACATCTGAGGTTTCTCGAGAAACCTCAGATGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1364s1c1
Sequence:CCGGCGTCAGTGGAAACATATTTATCTCGAGATAAATATGTTTCCACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023598.1-1126s1c1
Sequence:CCGGGCCGAAGAATAACCACAATAACTCGAGTTATTGTGGTTATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1229s1c1
Sequence:CCGGGCCCTGTATAAATACATGAAACTCGAGTTTCATGTATTTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023598.1-2493s1c1
Sequence:CCGGCCATCCGTAATCCAACATGTTCTCGAGAACATGTTGGATTACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-101s21c1
Sequence:CCGGCTTGAAGGCAAACCAAGAATCCTCGAGGATTCTTGGTTTGCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-2645s21c1
Sequence:GTACCGGGAGAAGATCCACGTCAATTATCTCGAGATAATTGACGTGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-225s21c1
Sequence:CCGGTATCCAGCTCGAAACTTTATTCTCGAGAATAAAGTTTCGAGCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-154s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-56s21c1
Sequence:CCGGGGCTTGCACGGACCTTATATTCTCGAGAATATAAGGTCCGTGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023598
VALIDATED
ARID5B MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 5B (MRF1-like)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1632s1c1
Sequence:CCGGCCCAAGATACATCTGAGGTTTCTCGAGAAACCTCAGATGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1364s1c1
Sequence:CCGGCGTCAGTGGAAACATATTTATCTCGAGATAAATATGTTTCCACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023598.1-1126s1c1
Sequence:CCGGGCCGAAGAATAACCACAATAACTCGAGTTATTGTGGTTATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1229s1c1
Sequence:CCGGGCCCTGTATAAATACATGAAACTCGAGTTTCATGTATTTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023598.1-2493s1c1
Sequence:CCGGCCATCCGTAATCCAACATGTTCTCGAGAACATGTTGGATTACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-101s21c1
Sequence:CCGGCTTGAAGGCAAACCAAGAATCCTCGAGGATTCTTGGTTTGCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-2645s21c1
Sequence:GTACCGGGAGAAGATCCACGTCAATTATCTCGAGATAATTGACGTGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-225s21c1
Sequence:CCGGTATCCAGCTCGAAACTTTATTCTCGAGAATAAAGTTTCGAGCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-154s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-56s21c1
Sequence:CCGGGGCTTGCACGGACCTTATATTCTCGAGAATATAAGGTCCGTGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023598
VALIDATED
ARID5B MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 5B (MRF1-like)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1632s1c1
Sequence:CCGGCCCAAGATACATCTGAGGTTTCTCGAGAAACCTCAGATGTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1364s1c1
Sequence:CCGGCGTCAGTGGAAACATATTTATCTCGAGATAAATATGTTTCCACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023598.1-1126s1c1
Sequence:CCGGGCCGAAGAATAACCACAATAACTCGAGTTATTGTGGTTATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023598.1-1229s1c1
Sequence:CCGGGCCCTGTATAAATACATGAAACTCGAGTTTCATGTATTTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023598.1-2493s1c1
Sequence:CCGGCCATCCGTAATCCAACATGTTCTCGAGAACATGTTGGATTACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-101s21c1
Sequence:CCGGCTTGAAGGCAAACCAAGAATCCTCGAGGATTCTTGGTTTGCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-2645s21c1
Sequence:GTACCGGGAGAAGATCCACGTCAATTATCTCGAGATAATTGACGTGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-225s21c1
Sequence:CCGGTATCCAGCTCGAAACTTTATTCTCGAGAATAAAGTTTCGAGCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-154s21c1
Sequence:CCGGTACGCCAAAGGATCCGATTTGCTCGAGCAAATCGGATCCTTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023598.2-56s21c1
Sequence:CCGGGGCTTGCACGGACCTTATATTCTCGAGAATATAAGGTCCGTGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks