EMAIL THIS PAGE TO A FRIEND

ARIH1

ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

85 Gene Product Result for
Synonyms: ARI HARI HHARI UBCH7BP
UniProtKB ID: Q9Y4X5, B2R6U3, O76026, Q9H3T6, Q9UEN0, Q9UP39
Gene ID:
Mouse(23806) ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila)
Rat(300756) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
naked mole-rat(101718033) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
domestic guinea pig(100713227) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
sheep(101116578) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Zebrafish(327005) ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila)
chicken(415319) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
cow(508410) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Horse(100063423) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
domestic cat(101091116) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
dog(478359) ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005744 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005744 Rosetta Predictions human pricing
NM_001013108 Rosetta Predictions rat pricing
NM_019927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057454 predicted 858
2 SASI_Hs02_00340187 predicted 2028
3 SASI_Hs01_00057455 predicted 855
4 SASI_Hs01_00057456 predicted 1237
5 SASI_Hs02_00340188 predicted 1981
6 SASI_Hs02_00340189 predicted 1151
7 SASI_Hs01_00057457 predicted 1198
8 SASI_Hs01_00057459 predicted 1391
9 SASI_Hs01_00057460 predicted 1022
10 SASI_Hs01_00057461 predicted 1450
11 SASI_Hs01_00057453 predicted 1604
12 SASI_Hs01_00057458 predicted 1353
13 SASI_Hs01_00057462 predicted 1898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200791 predicted 2002
2 SASI_Rn01_00049128 predicted 799
3 SASI_Rn02_00200792 predicted 1197
4 SASI_Rn02_00200793 predicted 821
5 SASI_Rn02_00200794 predicted 1979
6 SASI_Rn01_00049130 predicted 1404
7 SASI_Rn01_00049129 predicted 1290
8 SASI_Rn01_00049131 predicted 886
9 SASI_Rn01_00049132 predicted 970
10 SASI_Rn02_00200795 predicted 1614
11 SASI_Rn01_00049124 predicted 1399
12 SASI_Rn01_00049125 predicted 1306
13 SASI_Rn01_00049126 predicted 1451
14 SASI_Rn01_00049127 predicted 1431
15 SASI_Rn01_00049133 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105545 predicted 1753
2 SASI_Mm01_00105546 predicted 1298
3 SASI_Mm01_00105547 predicted 1776
4 SASI_Mm01_00105548 predicted 960
5 SASI_Mm02_00325207 predicted 1436
6 SASI_Mm01_00105549 predicted 1163
7 SASI_Mm01_00105550 predicted 1102
8 SASI_Mm01_00105551 predicted 1734
9 SASI_Mm01_00105552 predicted 1052
10 SASI_Mm01_00105553 predicted 643
11 SASI_Mm01_00105554 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019927
VALIDATED
ARIH1 MISSION shRNA Bacterial Glycerol Stock
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1479s21c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-400s21c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1737s21c1
Sequence:CCGGTAGAGTGCTCATGCAATTAAACTCGAGTTTAATTGCATGAGCACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1541s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019927.2-1113s21c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-320s1c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1399s1c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1033s1c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019927
VALIDATED
ARIH1 MISSION shRNA shRNA Plasmid DNA
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1479s21c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-400s21c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1737s21c1
Sequence:CCGGTAGAGTGCTCATGCAATTAAACTCGAGTTTAATTGCATGAGCACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1541s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019927.2-1113s21c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-320s1c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1399s1c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1033s1c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019927
VALIDATED
ARIH1 MISSION shRNA Lentiviral Transduction Particles
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1479s21c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-400s21c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1737s21c1
Sequence:CCGGTAGAGTGCTCATGCAATTAAACTCGAGTTTAATTGCATGAGCACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019927.2-1541s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019927.2-1113s21c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-320s1c1
Sequence:CCGGCCAGCAACTATCACGAGAATACTCGAGTATTCTCGTGATAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1399s1c1
Sequence:CCGGCCAGTCCATTATCTTTGAGAACTCGAGTTCTCAAAGATAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019927.1-1033s1c1
Sequence:CCGGCCAGAACTGTAAAGCAGAATTCTCGAGAATTCTGCTTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005744
VALIDATED
ARIH1 MISSION shRNA Bacterial Glycerol Stock
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1560s21c1
Sequence:CCGGTTCTACTGTAATCGCTATATGCTCGAGCATATAGCGATTACAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-887s21c1
Sequence:CCGGGAACTACCCTAACTCGTATTTCTCGAGAAATACGAGTTAGGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1834s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-721s21c1
Sequence:CCGGGCCACTTCAATTGGGATAAAGCTCGAGCTTTATCCCAATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1160s21c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1160s1c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1834s1c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005744.2-1254s1c1
Sequence:CCGGCCTGTTAAATGTAAGTGGTTACTCGAGTAACCACTTACATTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005744.2-2025s1c1
Sequence:CCGGCCATCTAGAGTGCTCATGCAACTCGAGTTGCATGAGCACTCTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-832s1c1
Sequence:CCGGGCCAGATGAATACAAGGTCATCTCGAGATGACCTTGTATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005744
VALIDATED
ARIH1 MISSION shRNA shRNA Plasmid DNA
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1560s21c1
Sequence:CCGGTTCTACTGTAATCGCTATATGCTCGAGCATATAGCGATTACAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-887s21c1
Sequence:CCGGGAACTACCCTAACTCGTATTTCTCGAGAAATACGAGTTAGGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1834s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-721s21c1
Sequence:CCGGGCCACTTCAATTGGGATAAAGCTCGAGCTTTATCCCAATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1160s21c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1160s1c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1834s1c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005744.2-1254s1c1
Sequence:CCGGCCTGTTAAATGTAAGTGGTTACTCGAGTAACCACTTACATTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005744.2-2025s1c1
Sequence:CCGGCCATCTAGAGTGCTCATGCAACTCGAGTTGCATGAGCACTCTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-832s1c1
Sequence:CCGGGCCAGATGAATACAAGGTCATCTCGAGATGACCTTGTATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005744
VALIDATED
ARIH1 MISSION shRNA Lentiviral Transduction Particles
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1560s21c1
Sequence:CCGGTTCTACTGTAATCGCTATATGCTCGAGCATATAGCGATTACAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-887s21c1
Sequence:CCGGGAACTACCCTAACTCGTATTTCTCGAGAAATACGAGTTAGGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1834s21c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-721s21c1
Sequence:CCGGGCCACTTCAATTGGGATAAAGCTCGAGCTTTATCCCAATTGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005744.3-1160s21c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1160s1c1
Sequence:CCGGCCATGTTGTTAAAGTCCAATACTCGAGTATTGGACTTTAACAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-1834s1c1
Sequence:CCGGGCTACCTTGAACGAGATATTTCTCGAGAAATATCTCGTTCAAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005744.2-1254s1c1
Sequence:CCGGCCTGTTAAATGTAAGTGGTTACTCGAGTAACCACTTACATTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005744.2-2025s1c1
Sequence:CCGGCCATCTAGAGTGCTCATGCAACTCGAGTTGCATGAGCACTCTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005744.2-832s1c1
Sequence:CCGGGCCAGATGAATACAAGGTCATCTCGAGATGACCTTGTATTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks