EMAIL THIS PAGE TO A FRIEND

ARIH2

ariadne homolog 2 (Drosophila)

169 Gene Product Result for
Synonyms: ARI2 TRIAD1
UniProtKB ID: O95376, Q9HBZ6, Q9UEM9
Gene ID:
Mouse(23807) ariadne homolog 2 (Drosophila)
Rat(316005) ariadne homolog 2 (Drosophila)
Zebrafish(406417) ariadne homolog 2 (Drosophila)
cow(505320) ariadne homolog 2 (Drosophila)
Horse(100053691) ariadne homolog 2 (Drosophila)
domestic cat(101101117) ariadne homolog 2 (Drosophila)
dog(476633) ariadne homolog 2 (Drosophila)
chicken(416061) ariadne homolog 2 (Drosophila)
sheep(101109306) ariadne homolog 2 (Drosophila)
Domestic Rabbit(100353098) ariadne homolog 2 (Drosophila)
domestic guinea pig(100729753) ariadne homolog 2 (Drosophila)
naked mole-rat(101696643) ariadne homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5358 Anti-ARIH2 (381-395) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A5483 Anti-ARIH2 (421-435) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501141 Anti-ARIH2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunoprecipitation, western blot pricing
SAB1406988 Anti-ARIH2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV34418 Anti-ARIH2 antibody produced in rabbit IgG fraction of antiserum horse, rabbit, bovine, rat, mouse, guinea pig, canine, human
immunohistochemistry, western blot pricing
HPA067381 Anti-ARIH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA069715 Anti-ARIH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA070963 Anti-ARIH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0010425M1 Monoclonal Anti-ARIH2 antibody produced in mouse clone 1C3, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006321 Rosetta Predictions human pricing
NM_001012275 Rosetta Predictions rat pricing
NM_011790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230799 predicted 1170
2 SASI_Hs01_00230800 predicted 922
3 SASI_Hs01_00230801 predicted 1239
4 SASI_Hs02_00341344 predicted 905
5 SASI_Hs01_00230802 predicted 1164
6 SASI_Hs01_00230804 predicted 614
7 SASI_Hs01_00230805 predicted 1784
8 SASI_Hs01_00230806 predicted 1457
9 SASI_Hs02_00341345 predicted 1471
10 SASI_Hs01_00230807 predicted 1395
11 SASI_Hs01_00230803 predicted 636
12 SASI_Hs01_00230808 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072866 predicted 432
2 SASI_Rn02_00200520 predicted 1048
3 SASI_Rn01_00072867 predicted 739
4 SASI_Rn01_00072869 predicted 438
5 SASI_Rn01_00072871 predicted 1444
6 SASI_Rn01_00072872 predicted 225
7 SASI_Rn01_00072873 predicted 1077
8 SASI_Rn01_00072874 predicted 1117
9 SASI_Rn02_00200521 predicted 788
10 SASI_Rn01_00072875 predicted 1140
11 SASI_Rn01_00072868 predicted 1632
12 SASI_Rn01_00072870 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121321 predicted 1449
2 SASI_Mm02_00321441 predicted 553
3 SASI_Mm01_00121322 predicted 1197
4 SASI_Mm01_00121323 predicted 1162
5 SASI_Mm01_00121324 predicted 1318
6 SASI_Mm01_00121325 predicted 546
7 SASI_Mm01_00121326 predicted 1513
8 SASI_Mm01_00121327 predicted 851
9 SASI_Mm01_00121328 predicted 1230
10 SASI_Mm01_00121329 predicted 1384
11 SASI_Mm01_00121330 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006321
VALIDATED
ARIH2 MISSION shRNA Bacterial Glycerol Stock
ariadne homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006321.1-2500s1c1
Sequence:CCGGCCTCCCAAATAAATTTGCTTTCTCGAGAAAGCAAATTTATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1413s1c1
Sequence:CCGGCCTGCAATACACCTACCCATACTCGAGTATGGGTAGGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-990s1c1
Sequence:CCGGCGACTCTGAAACAGCCAACTACTCGAGTAGTTGGCTGTTTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-250s1c1
Sequence:CCGGGAGGACTATTACGTGGGAGTACTCGAGTACTCCCACGTAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1112s1c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1392s21c1
Sequence:CCGGAGCCCTCAAGAAGTACTTATTCTCGAGAATAAGTACTTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006321.2-1925s21c1
Sequence:CCGGGCAACACCTCTTAGTTGATTTCTCGAGAAATCAACTAAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1119s21c1
Sequence:CCGGCTGTGCCACAATCCGGAAATGCTCGAGCATTTCCGGATTGTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1280s21c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006321
VALIDATED
ARIH2 MISSION shRNA shRNA Plasmid DNA
ariadne homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006321.1-2500s1c1
Sequence:CCGGCCTCCCAAATAAATTTGCTTTCTCGAGAAAGCAAATTTATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1413s1c1
Sequence:CCGGCCTGCAATACACCTACCCATACTCGAGTATGGGTAGGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-990s1c1
Sequence:CCGGCGACTCTGAAACAGCCAACTACTCGAGTAGTTGGCTGTTTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-250s1c1
Sequence:CCGGGAGGACTATTACGTGGGAGTACTCGAGTACTCCCACGTAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1112s1c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1392s21c1
Sequence:CCGGAGCCCTCAAGAAGTACTTATTCTCGAGAATAAGTACTTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006321.2-1925s21c1
Sequence:CCGGGCAACACCTCTTAGTTGATTTCTCGAGAAATCAACTAAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1119s21c1
Sequence:CCGGCTGTGCCACAATCCGGAAATGCTCGAGCATTTCCGGATTGTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1280s21c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006321
VALIDATED
ARIH2 MISSION shRNA Lentiviral Transduction Particles
ariadne homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006321.1-2500s1c1
Sequence:CCGGCCTCCCAAATAAATTTGCTTTCTCGAGAAAGCAAATTTATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1413s1c1
Sequence:CCGGCCTGCAATACACCTACCCATACTCGAGTATGGGTAGGTGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-990s1c1
Sequence:CCGGCGACTCTGAAACAGCCAACTACTCGAGTAGTTGGCTGTTTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-250s1c1
Sequence:CCGGGAGGACTATTACGTGGGAGTACTCGAGTACTCCCACGTAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006321.1-1112s1c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1392s21c1
Sequence:CCGGAGCCCTCAAGAAGTACTTATTCTCGAGAATAAGTACTTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006321.2-1925s21c1
Sequence:CCGGGCAACACCTCTTAGTTGATTTCTCGAGAAATCAACTAAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1119s21c1
Sequence:CCGGCTGTGCCACAATCCGGAAATGCTCGAGCATTTCCGGATTGTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006321.2-1280s21c1
Sequence:CCGGGCTGGATGTGTCTAGGAGATTCTCGAGAATCTCCTAGACACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011790
VALIDATED
ARIH2 MISSION shRNA Bacterial Glycerol Stock
ariadne homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-408s1c1
Sequence:CCGGGAGGACTACTATGTGGGAGTACTCGAGTACTCCCACATAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-907s1c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1449s1c1
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-936s1c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1614s1c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-936s21c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1449s21c2
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1614s21c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-907s21c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011790
VALIDATED
ARIH2 MISSION shRNA shRNA Plasmid DNA
ariadne homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-408s1c1
Sequence:CCGGGAGGACTACTATGTGGGAGTACTCGAGTACTCCCACATAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-907s1c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1449s1c1
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-936s1c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1614s1c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-936s21c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1449s21c2
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1614s21c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-907s21c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011790
VALIDATED
ARIH2 MISSION shRNA Lentiviral Transduction Particles
ariadne homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-408s1c1
Sequence:CCGGGAGGACTACTATGTGGGAGTACTCGAGTACTCCCACATAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-907s1c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1449s1c1
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-936s1c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011790.2-1614s1c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-936s21c1
Sequence:CCGGCGCTACCTCTTTAGGGACTATCTCGAGATAGTCCCTAAAGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1449s21c2
Sequence:CCGGGCACAAACATATGAGCGGATTCTCGAGAATCCGCTCATATGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-1614s21c1
Sequence:CCGGCCCAGGAAGAAGCTGTTTGAACTCGAGTTCAAACAGCTTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011790.4-907s21c1
Sequence:CCGGCCAATGAAGAATTGAGAGATACTCGAGTATCTCTCAATTCTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks