EMAIL THIS PAGE TO A FRIEND

ARIH2OS

ariadne homolog 2 opposite strand

23 Gene Product Result for
Synonyms: C3orf71
Species: Human ARIH2OS(646450), domestic guinea pig Arih2os(101787967)
UniProtKB ID: Q8N7S6
Gene ID:
domestic guinea pig(101787967) ariadne homolog 2 opposite strand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123040 Rosetta Predictions human pricing
XM_929378 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327667 predicted 1050
2 SASI_Hs02_00327668 predicted 988
3 SASI_Hs02_00327669 predicted 839
4 SASI_Hs02_00327670 predicted 824
5 SASI_Hs02_00327671 predicted 363
6 SASI_Hs02_00327672 predicted 1002
7 SASI_Hs02_00327673 predicted 642
8 SASI_Hs02_00327674 predicted 658
9 SASI_Hs02_00327675 predicted 1011
10 SASI_Hs02_00327676 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301284 predicted 1070
2 SASI_Hs01_00301285 predicted 1005
3 SASI_Hs01_00301286 predicted 992
4 SASI_Hs01_00301287 predicted 996
5 SASI_Hs01_00301288 predicted 1022
6 SASI_Hs01_00301289 predicted 1021
7 SASI_Hs01_00301290 predicted 994
8 SASI_Hs01_00301291 predicted 1068
9 SASI_Hs01_00301292 predicted 1036
10 SASI_Hs01_00301293 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123040
ARIH2OS MISSION shRNA Bacterial Glycerol Stock
ariadne homolog 2 opposite strand
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-823s21c1
Sequence:CCGGTGGCGTCAGTGGAGCAGATAACTCGAGTTATCTGCTCCACTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1006s21c1
Sequence:CCGGCCGTGCAAGATTGCATCTTAACTCGAGTTAAGATGCAATCTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1065s21c1
Sequence:CCGGGTCATCATGACTTCCAGTTACCTCGAGGTAACTGGAAGTCATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1087s21c1
Sequence:CCGGTTCTGGGACCGGTTGTCAAATCTCGAGATTTGACAACCGGTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123040
ARIH2OS MISSION shRNA shRNA Plasmid DNA
ariadne homolog 2 opposite strand
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-823s21c1
Sequence:CCGGTGGCGTCAGTGGAGCAGATAACTCGAGTTATCTGCTCCACTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1006s21c1
Sequence:CCGGCCGTGCAAGATTGCATCTTAACTCGAGTTAAGATGCAATCTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1065s21c1
Sequence:CCGGGTCATCATGACTTCCAGTTACCTCGAGGTAACTGGAAGTCATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1087s21c1
Sequence:CCGGTTCTGGGACCGGTTGTCAAATCTCGAGATTTGACAACCGGTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123040
ARIH2OS MISSION shRNA Lentiviral Transduction Particles
ariadne homolog 2 opposite strand
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-823s21c1
Sequence:CCGGTGGCGTCAGTGGAGCAGATAACTCGAGTTATCTGCTCCACTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1006s21c1
Sequence:CCGGCCGTGCAAGATTGCATCTTAACTCGAGTTAAGATGCAATCTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1065s21c1
Sequence:CCGGGTCATCATGACTTCCAGTTACCTCGAGGTAACTGGAAGTCATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123040.1-1087s21c1
Sequence:CCGGTTCTGGGACCGGTTGTCAAATCTCGAGATTTGACAACCGGTCCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks