EMAIL THIS PAGE TO A FRIEND

ARL10

ADP-ribosylation factor-like 10

119 Gene Product Result for
Synonyms: ARL10A
UniProtKB ID: Q8N8L6
Gene ID:
Mouse(56795) ADP-ribosylation factor-like 10
Rat(306767) ADP-ribosylation factor-like 10
sheep(101105498) ADP-ribosylation factor-like 10
naked mole-rat(101714560) ADP-ribosylation factor-like 10
domestic guinea pig(100730833) ADP-ribosylation factor-like 10
Zebrafish(560654) ADP-ribosylation factor-like 10
cow(614282) ADP-ribosylation factor-like 10
domestic cat(101082718) ADP-ribosylation factor-like 10
dog(489105) ADP-ribosylation factor-like 10
chicken(416229) ADP-ribosylation factor-like 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173664 Rosetta Predictions human pricing
NM_207165 Rosetta Predictions rat pricing
NM_019968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181121 predicted 471
2 SASI_Hs01_00181122 predicted 820
3 SASI_Hs01_00181124 predicted 662
4 SASI_Hs01_00181125 predicted 331
5 SASI_Hs02_00368588 predicted 467
6 SASI_Hs02_00368589 predicted 671
7 SASI_Hs01_00181127 predicted 1020
8 SASI_Hs01_00181128 predicted 814
9 SASI_Hs02_00368590 predicted 669
10 SASI_Hs02_00368591 predicted 466
11 SASI_Hs01_00181123 predicted 889
12 SASI_Hs01_00181126 predicted 462
13 SASI_Hs01_00181129 predicted 974
14 SASI_Hs01_00181130 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038599 predicted 453
2 SASI_Rn01_00038600 predicted 296
3 SASI_Rn02_00270399 predicted 494
4 SASI_Rn01_00038601 predicted 384
5 SASI_Rn01_00038602 predicted 205
6 SASI_Rn01_00038603 predicted 437
7 SASI_Rn01_00038604 predicted 449
8 SASI_Rn01_00038605 predicted 259
9 SASI_Rn01_00038606 predicted 206
10 SASI_Rn01_00038607 predicted 509
11 SASI_Rn01_00038608 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149891 predicted 717
2 SASI_Mm01_00149892 predicted 471
3 SASI_Mm01_00149893 predicted 364
4 SASI_Mm01_00149894 predicted 546
5 SASI_Mm01_00149895 predicted 713
6 SASI_Mm01_00149896 predicted 711
7 SASI_Mm01_00149897 predicted 600
8 SASI_Mm01_00149898 predicted 323
9 SASI_Mm01_00149900 predicted 375
10 SASI_Mm02_00325270 predicted 273
11 SASI_Mm01_00149899 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019968
ARL10 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019968.1-102s1c1
Sequence:CCGGCTTTATCCTCTGGAAAGCTTACTCGAGTAAGCTTTCCAGAGGATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019968.1-785s21c1
Sequence:CCGGCCAGCCTTGAATACCACATTTCTCGAGAAATGTGGTATTCAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-86s21c1
Sequence:CCGGTGCTGGGCTCTGTGCTCTTTACTCGAGTAAAGAGCACAGAGCCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-633s21c1
Sequence:CCGGGGGCCTCCTTGCTAGTTATAACTCGAGTTATAACTAGCAAGGAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-372s21c1
Sequence:CCGGTCGGCTGCCTACCAAGAATTTCTCGAGAAATTCTTGGTAGGCAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-552s21c1
Sequence:CCGGTCCGGATCTGCCTGTTGTTATCTCGAGATAACAACAGGCAGATCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019968
ARL10 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019968.1-102s1c1
Sequence:CCGGCTTTATCCTCTGGAAAGCTTACTCGAGTAAGCTTTCCAGAGGATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019968.1-785s21c1
Sequence:CCGGCCAGCCTTGAATACCACATTTCTCGAGAAATGTGGTATTCAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-86s21c1
Sequence:CCGGTGCTGGGCTCTGTGCTCTTTACTCGAGTAAAGAGCACAGAGCCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-633s21c1
Sequence:CCGGGGGCCTCCTTGCTAGTTATAACTCGAGTTATAACTAGCAAGGAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-372s21c1
Sequence:CCGGTCGGCTGCCTACCAAGAATTTCTCGAGAAATTCTTGGTAGGCAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-552s21c1
Sequence:CCGGTCCGGATCTGCCTGTTGTTATCTCGAGATAACAACAGGCAGATCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019968
ARL10 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019968.1-102s1c1
Sequence:CCGGCTTTATCCTCTGGAAAGCTTACTCGAGTAAGCTTTCCAGAGGATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019968.1-785s21c1
Sequence:CCGGCCAGCCTTGAATACCACATTTCTCGAGAAATGTGGTATTCAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-86s21c1
Sequence:CCGGTGCTGGGCTCTGTGCTCTTTACTCGAGTAAAGAGCACAGAGCCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-633s21c1
Sequence:CCGGGGGCCTCCTTGCTAGTTATAACTCGAGTTATAACTAGCAAGGAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-372s21c1
Sequence:CCGGTCGGCTGCCTACCAAGAATTTCTCGAGAAATTCTTGGTAGGCAGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019968.1-552s21c1
Sequence:CCGGTCCGGATCTGCCTGTTGTTATCTCGAGATAACAACAGGCAGATCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173664
ARL10 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1766s1c1
Sequence:CCGGCCCAGATGACAGTCATAGAAACTCGAGTTTCTATGACTGTCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2300s1c1
Sequence:CCGGCCACTAAATCAACAACCACAACTCGAGTTGTGGTTGTTGATTTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173664.3-761s1c1
Sequence:CCGGGCACATCTGGAAACTGCTCTTCTCGAGAAGAGCAGTTTCCAGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1725s1c1
Sequence:CCGGCCAGAGTTCTAGGCTCTGTTTCTCGAGAAACAGAGCCTAGAACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2467s1c1
Sequence:CCGGCCTGGCAAAGATTTGCAGTAACTCGAGTTACTGCAAATCTTTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1095s21c1
Sequence:CCGGAGATGCTCAGTGGGCTCAATCCTCGAGGATTGAGCCCACTGAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1195s21c1
Sequence:CCGGGAAACAGTCTGGTGACGTCATCTCGAGATGACGTCACCAGACTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173664
ARL10 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1766s1c1
Sequence:CCGGCCCAGATGACAGTCATAGAAACTCGAGTTTCTATGACTGTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2300s1c1
Sequence:CCGGCCACTAAATCAACAACCACAACTCGAGTTGTGGTTGTTGATTTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173664.3-761s1c1
Sequence:CCGGGCACATCTGGAAACTGCTCTTCTCGAGAAGAGCAGTTTCCAGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1725s1c1
Sequence:CCGGCCAGAGTTCTAGGCTCTGTTTCTCGAGAAACAGAGCCTAGAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2467s1c1
Sequence:CCGGCCTGGCAAAGATTTGCAGTAACTCGAGTTACTGCAAATCTTTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1095s21c1
Sequence:CCGGAGATGCTCAGTGGGCTCAATCCTCGAGGATTGAGCCCACTGAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1195s21c1
Sequence:CCGGGAAACAGTCTGGTGACGTCATCTCGAGATGACGTCACCAGACTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173664
ARL10 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1766s1c1
Sequence:CCGGCCCAGATGACAGTCATAGAAACTCGAGTTTCTATGACTGTCATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2300s1c1
Sequence:CCGGCCACTAAATCAACAACCACAACTCGAGTTGTGGTTGTTGATTTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173664.3-761s1c1
Sequence:CCGGGCACATCTGGAAACTGCTCTTCTCGAGAAGAGCAGTTTCCAGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-1725s1c1
Sequence:CCGGCCAGAGTTCTAGGCTCTGTTTCTCGAGAAACAGAGCCTAGAACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173664.3-2467s1c1
Sequence:CCGGCCTGGCAAAGATTTGCAGTAACTCGAGTTACTGCAAATCTTTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1095s21c1
Sequence:CCGGAGATGCTCAGTGGGCTCAATCCTCGAGGATTGAGCCCACTGAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173664.4-1195s21c1
Sequence:CCGGGAAACAGTCTGGTGACGTCATCTCGAGATGACGTCACCAGACTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)