EMAIL THIS PAGE TO A FRIEND

ARL11

ADP-ribosylation factor-like 11

51 Gene Product Result for
Synonyms: ARLTS1
UniProtKB ID: Q969Q4
Gene ID:
Human(115761) Summary: This gene encodes a tumor suppressor related to the ADP-ribosylation factor (ARF) family of proteins. The encoded protein may play a role in apoptosis in a caspase-dependent manner. Polymorphisms in this gene have been associated with some familial cancers. [provided by RefSeq, May 2010]
Mouse(219144) ADP-ribosylation factor-like 11
Rat(364396) ADP-ribosylation factor-like 11
Zebrafish(324689) ADP-ribosylation factor-like 11
cow(513113) ADP-ribosylation factor-like 11
domestic cat(101099856) ADP-ribosylation factor-like 11
chicken(418869) ADP-ribosylation factor-like 11
domestic guinea pig(100717686) ADP-ribosylation factor-like 11
naked mole-rat(101724163) ADP-ribosylation factor-like 11
sheep(101117343) ADP-ribosylation factor-like 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012761 MISSION® esiRNA esiRNA targeting human ARL11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138450 Rosetta Predictions human pricing
NM_001013433 Rosetta Predictions rat pricing
NM_177337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246084 predicted 312
2 SASI_Hs01_00246085 predicted 381
3 SASI_Hs01_00246086 predicted 216
4 SASI_Hs01_00246087 predicted 361
5 SASI_Hs02_00363620 predicted 273
6 SASI_Hs01_00246088 predicted 384
7 SASI_Hs01_00246089 predicted 397
8 SASI_Hs01_00246090 predicted 518
9 SASI_Hs01_00246091 predicted 526
10 SASI_Hs01_00246092 predicted 215
11 SASI_Hs01_00246093 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038379 predicted 1062
2 SASI_Rn01_00038380 predicted 1031
3 SASI_Rn01_00038381 predicted 241
4 SASI_Rn01_00038382 predicted 1045
5 SASI_Rn01_00038383 predicted 1154
6 SASI_Rn01_00038384 predicted 447
7 SASI_Rn02_00201108 predicted 1184
8 SASI_Rn01_00038385 predicted 595
9 SASI_Rn01_00038386 predicted 738
10 SASI_Rn01_00038387 predicted 877
11 SASI_Rn01_00038388 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087540 predicted 661
2 SASI_Mm01_00087541 predicted 460
3 SASI_Mm01_00087542 predicted 1195
4 SASI_Mm01_00087543 predicted 809
5 SASI_Mm01_00087544 predicted 884
6 SASI_Mm01_00087545 predicted 670
7 SASI_Mm01_00087546 predicted 491
8 SASI_Mm01_00087547 predicted 358
9 SASI_Mm01_00087548 predicted 887
10 SASI_Mm01_00087549 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138450
ARL11 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 11
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1168s21c1
Sequence:GTACCGGGCTCGTTACCAAGTGTGAATGCTCGAGCATTCACACTTGGTAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-736s21c1
Sequence:GTACCGGGATCCAGACAGAGCAGCATATCTCGAGATATGCTGCTCTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-383s21c1
Sequence:GTACCGGAGGCACAGATATCCTCGTGTACTCGAGTACACGAGGATATCTGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-535s21c1
Sequence:GTACCGGTTCCGCTGCTTAAGATCAGAACTCGAGTTCTGATCTTAAGCAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1233s21c1
Sequence:GTACCGGGAGACCTAAATTCTCAAATAGCTCGAGCTATTTGAGAATTTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-796s21c1
Sequence:GTACCGGGAAATTTACGCTTAGTCTATCCTCGAGGATAGACTAAGCGTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-359s21c1
Sequence:GTACCGGAGCCAGCTGGAAGGACTATCTCTCGAGAGATAGTCCTTCCAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-224s21c1
Sequence:GTACCGGCACGCTCCTTTACAAGCTGAACTCGAGTTCAGCTTGTAAAGGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-449s21c1
Sequence:GTACCGGTGAGCTCACAGAAGTCCTGAACTCGAGTTCAGGACTTCTGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-414s21c1
Sequence:GTACCGGAGCACAGATGAAGCCCGCTTACTCGAGTAAGCGGGCTTCATCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-2137s1c1
Sequence:CCGGGAGCATTTAGTTTGTGGCAAACTCGAGTTTGCCACAAACTAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-731s1c1
Sequence:CCGGGCTTAAGATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-407s1c1
Sequence:CCGGCAAGACCACGCTCCTTTACAACTCGAGTTGTAAAGGAGCGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-737s1c1
Sequence:CCGGGATCAGAAACAGGCTGAGTCTCTCGAGAGACTCAGCCTGTTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-1781s1c1
Sequence:CCGGGCGGATCCTTATGAGTGATTTCTCGAGAAATCACTCATAAGGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138450.3-2727s1c1
Sequence:CCGGGCTGTGTTAGACACTAGGGATCTCGAGATCCCTAGTGTCTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138450
ARL11 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 11
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1168s21c1
Sequence:GTACCGGGCTCGTTACCAAGTGTGAATGCTCGAGCATTCACACTTGGTAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-736s21c1
Sequence:GTACCGGGATCCAGACAGAGCAGCATATCTCGAGATATGCTGCTCTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-383s21c1
Sequence:GTACCGGAGGCACAGATATCCTCGTGTACTCGAGTACACGAGGATATCTGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-535s21c1
Sequence:GTACCGGTTCCGCTGCTTAAGATCAGAACTCGAGTTCTGATCTTAAGCAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1233s21c1
Sequence:GTACCGGGAGACCTAAATTCTCAAATAGCTCGAGCTATTTGAGAATTTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-796s21c1
Sequence:GTACCGGGAAATTTACGCTTAGTCTATCCTCGAGGATAGACTAAGCGTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-359s21c1
Sequence:GTACCGGAGCCAGCTGGAAGGACTATCTCTCGAGAGATAGTCCTTCCAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-224s21c1
Sequence:GTACCGGCACGCTCCTTTACAAGCTGAACTCGAGTTCAGCTTGTAAAGGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-449s21c1
Sequence:GTACCGGTGAGCTCACAGAAGTCCTGAACTCGAGTTCAGGACTTCTGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-414s21c1
Sequence:GTACCGGAGCACAGATGAAGCCCGCTTACTCGAGTAAGCGGGCTTCATCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-2137s1c1
Sequence:CCGGGAGCATTTAGTTTGTGGCAAACTCGAGTTTGCCACAAACTAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-731s1c1
Sequence:CCGGGCTTAAGATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-407s1c1
Sequence:CCGGCAAGACCACGCTCCTTTACAACTCGAGTTGTAAAGGAGCGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-737s1c1
Sequence:CCGGGATCAGAAACAGGCTGAGTCTCTCGAGAGACTCAGCCTGTTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-1781s1c1
Sequence:CCGGGCGGATCCTTATGAGTGATTTCTCGAGAAATCACTCATAAGGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138450.3-2727s1c1
Sequence:CCGGGCTGTGTTAGACACTAGGGATCTCGAGATCCCTAGTGTCTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138450
ARL11 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 11
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1168s21c1
Sequence:GTACCGGGCTCGTTACCAAGTGTGAATGCTCGAGCATTCACACTTGGTAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-736s21c1
Sequence:GTACCGGGATCCAGACAGAGCAGCATATCTCGAGATATGCTGCTCTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-383s21c1
Sequence:GTACCGGAGGCACAGATATCCTCGTGTACTCGAGTACACGAGGATATCTGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-535s21c1
Sequence:GTACCGGTTCCGCTGCTTAAGATCAGAACTCGAGTTCTGATCTTAAGCAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-1233s21c1
Sequence:GTACCGGGAGACCTAAATTCTCAAATAGCTCGAGCTATTTGAGAATTTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138450.4-796s21c1
Sequence:GTACCGGGAAATTTACGCTTAGTCTATCCTCGAGGATAGACTAAGCGTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-359s21c1
Sequence:GTACCGGAGCCAGCTGGAAGGACTATCTCTCGAGAGATAGTCCTTCCAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-224s21c1
Sequence:GTACCGGCACGCTCCTTTACAAGCTGAACTCGAGTTCAGCTTGTAAAGGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-449s21c1
Sequence:GTACCGGTGAGCTCACAGAAGTCCTGAACTCGAGTTCAGGACTTCTGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138450.4-414s21c1
Sequence:GTACCGGAGCACAGATGAAGCCCGCTTACTCGAGTAAGCGGGCTTCATCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-2137s1c1
Sequence:CCGGGAGCATTTAGTTTGTGGCAAACTCGAGTTTGCCACAAACTAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-731s1c1
Sequence:CCGGGCTTAAGATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-407s1c1
Sequence:CCGGCAAGACCACGCTCCTTTACAACTCGAGTTGTAAAGGAGCGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138450.3-737s1c1
Sequence:CCGGGATCAGAAACAGGCTGAGTCTCTCGAGAGACTCAGCCTGTTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138450.3-1781s1c1
Sequence:CCGGGCGGATCCTTATGAGTGATTTCTCGAGAAATCACTCATAAGGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138450.3-2727s1c1
Sequence:CCGGGCTGTGTTAGACACTAGGGATCTCGAGATCCCTAGTGTCTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177337
ARL11 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 11
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-335s21c1
Sequence:GTACCGGTAATGATGGGCCTCGACTCTGCTCGAGCAGAGTCGAGGCCCATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-802s21c1
Sequence:GTACCGGTTGCTGAAGTCCCGCTGAAATCTCGAGATTTCAGCGGGACTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-1053s21c1
Sequence:GTACCGGACAATAGTCAGAGGGAATATACTCGAGTATATTCCCTCTGACTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-956s21c1
Sequence:GTACCGGACCACACGAGAAACCACAATTCTCGAGAATTGTGGTTTCTCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-548s21c1
Sequence:GTACCGGTGCTGGACAGCACAGATGAAGCTCGAGCTTCATCTGTGCTGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-881s21c1
Sequence:GTACCGGTGAGCGGGCAGAACAGCTTATCTCGAGATAAGCTGTTCTGCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-525s21c1
Sequence:GTACCGGAGGCATCGACCTCCTTGTGTACTCGAGTACACAAGGAGGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-672s21c1
Sequence:GTACCGGTGCTCTGCCGTTGCTTGAAATCTCGAGATTTCAAGCAACGGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177337.3-947s1c1
Sequence:CCGGGCTCAGTTTACCACACGAGAACTCGAGTTCTCGTGTGGTAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-678s1c1
Sequence:CCGGGCCGTTGCTTGAAATCAGAAACTCGAGTTTCTGATTTCAAGCAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-372s1c1
Sequence:CCGGTCTGTACAAACTGAAAGGAAACTCGAGTTTCCTTTCAGTTTGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-492s1c1
Sequence:CCGGCCAGCTCAGAGCTACCTGGAACTCGAGTTCCAGGTAGCTCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-684s1c1
Sequence:CCGGGCTTGAAATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177337
ARL11 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 11
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-335s21c1
Sequence:GTACCGGTAATGATGGGCCTCGACTCTGCTCGAGCAGAGTCGAGGCCCATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-802s21c1
Sequence:GTACCGGTTGCTGAAGTCCCGCTGAAATCTCGAGATTTCAGCGGGACTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-1053s21c1
Sequence:GTACCGGACAATAGTCAGAGGGAATATACTCGAGTATATTCCCTCTGACTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-956s21c1
Sequence:GTACCGGACCACACGAGAAACCACAATTCTCGAGAATTGTGGTTTCTCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-548s21c1
Sequence:GTACCGGTGCTGGACAGCACAGATGAAGCTCGAGCTTCATCTGTGCTGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-881s21c1
Sequence:GTACCGGTGAGCGGGCAGAACAGCTTATCTCGAGATAAGCTGTTCTGCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-525s21c1
Sequence:GTACCGGAGGCATCGACCTCCTTGTGTACTCGAGTACACAAGGAGGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-672s21c1
Sequence:GTACCGGTGCTCTGCCGTTGCTTGAAATCTCGAGATTTCAAGCAACGGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177337.3-947s1c1
Sequence:CCGGGCTCAGTTTACCACACGAGAACTCGAGTTCTCGTGTGGTAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-678s1c1
Sequence:CCGGGCCGTTGCTTGAAATCAGAAACTCGAGTTTCTGATTTCAAGCAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-372s1c1
Sequence:CCGGTCTGTACAAACTGAAAGGAAACTCGAGTTTCCTTTCAGTTTGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-492s1c1
Sequence:CCGGCCAGCTCAGAGCTACCTGGAACTCGAGTTCCAGGTAGCTCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-684s1c1
Sequence:CCGGGCTTGAAATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177337
ARL11 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 11
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-335s21c1
Sequence:GTACCGGTAATGATGGGCCTCGACTCTGCTCGAGCAGAGTCGAGGCCCATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-802s21c1
Sequence:GTACCGGTTGCTGAAGTCCCGCTGAAATCTCGAGATTTCAGCGGGACTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-1053s21c1
Sequence:GTACCGGACAATAGTCAGAGGGAATATACTCGAGTATATTCCCTCTGACTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-956s21c1
Sequence:GTACCGGACCACACGAGAAACCACAATTCTCGAGAATTGTGGTTTCTCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-548s21c1
Sequence:GTACCGGTGCTGGACAGCACAGATGAAGCTCGAGCTTCATCTGTGCTGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177337.3-881s21c1
Sequence:GTACCGGTGAGCGGGCAGAACAGCTTATCTCGAGATAAGCTGTTCTGCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-525s21c1
Sequence:GTACCGGAGGCATCGACCTCCTTGTGTACTCGAGTACACAAGGAGGTCGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177337.3-672s21c1
Sequence:GTACCGGTGCTCTGCCGTTGCTTGAAATCTCGAGATTTCAAGCAACGGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177337.3-947s1c1
Sequence:CCGGGCTCAGTTTACCACACGAGAACTCGAGTTCTCGTGTGGTAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-678s1c1
Sequence:CCGGGCCGTTGCTTGAAATCAGAAACTCGAGTTTCTGATTTCAAGCAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-372s1c1
Sequence:CCGGTCTGTACAAACTGAAAGGAAACTCGAGTTTCCTTTCAGTTTGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-492s1c1
Sequence:CCGGCCAGCTCAGAGCTACCTGGAACTCGAGTTCCAGGTAGCTCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177337.3-684s1c1
Sequence:CCGGGCTTGAAATCAGAAACAGGCTCTCGAGAGCCTGTTTCTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks