EMAIL THIS PAGE TO A FRIEND

ARL13A

ADP-ribosylation factor-like 13A

88 Gene Product Result for
Synonyms: ARL13 dJ341D10.2
UniProtKB ID: Q5H913, B2RTT6, B4DX50
Gene ID:
Mouse(74448) ADP-ribosylation factor-like 13A
Rat(501617) ADP-ribosylation factor-like 13A
sheep(101119452) ADP-ribosylation factor-like 13A
Zebrafish(793658) ADP-ribosylation factor-like 13A
cow(512780) ADP-ribosylation factor-like 13A
domestic cat(101091177) ADP-ribosylation factor-like 13A
dog(100687323) ADP-ribosylation factor-like 13A
chicken(422255) ADP-ribosylation factor-like 13A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012990 Rosetta Predictions human pricing
NM_001024366 Rosetta Predictions rat pricing
XM_001078508 Rosetta Predictions rat pricing
XM_136037 Rosetta Predictions mouse pricing
XM_904411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306297 predicted 797
2 SASI_Hs02_00306298 predicted 959
3 SASI_Hs02_00306299 predicted 856
4 SASI_Hs02_00306300 predicted 816
5 SASI_Hs02_00306301 predicted 1002
6 SASI_Hs02_00306302 predicted 952
7 SASI_Hs01_00197731 predicted 420
8 SASI_Hs01_00197735 predicted 666
9 SASI_Hs01_00197736 predicted 522
10 SASI_Hs02_00306303 predicted 1035
11 SASI_Hs01_00197730 predicted 433
12 SASI_Hs01_00197732 predicted 652
13 SASI_Hs01_00197733 predicted 341
14 SASI_Hs01_00197734 predicted 739
15 SASI_Hs01_00197737 predicted 595
16 SASI_Hs01_00197738 predicted 669
17 SASI_Hs01_00197739 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044167 predicted 287
2 SASI_Rn01_00044168 predicted 1091
3 SASI_Rn01_00044169 predicted 480
4 SASI_Rn01_00044170 predicted 322
5 SASI_Rn01_00044171 predicted 763
6 SASI_Rn01_00044172 predicted 1050
7 SASI_Rn02_00202598 predicted 608
8 SASI_Rn02_00202599 predicted 802
9 SASI_Rn01_00044173 predicted 961
10 SASI_Rn01_00044175 predicted 1360
11 SASI_Rn01_00044174 predicted 214
12 SASI_Rn01_00044176 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361049 predicted 342
2 SASI_Rn02_00361050 predicted 917
3 SASI_Rn02_00361051 predicted 304
4 SASI_Rn02_00361052 predicted 582
5 SASI_Rn02_00361053 predicted 873
6 SASI_Rn02_00361054 predicted 425
7 SASI_Rn02_00361055 predicted 624
8 SASI_Rn02_00361056 predicted 783
9 SASI_Rn02_00361057 predicted 770
10 SASI_Rn02_00361058 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223992 predicted 1504
2 SASI_Mm01_00223993 predicted 1503
3 SASI_Mm02_00424670 predicted 1382
4 SASI_Mm02_00424671 predicted 1494
5 SASI_Mm01_00223996 predicted 1416
6 SASI_Mm02_00424672 predicted 1446
7 SASI_Mm01_00223999 predicted 1414
8 SASI_Mm01_00224000 predicted 1430
9 SASI_Mm02_00424673 predicted 1417
10 SASI_Mm02_00424674 predicted 1393
11 SASI_Mm01_00223994 predicted 1391
12 SASI_Mm01_00223995 predicted 1423
13 SASI_Mm01_00223997 predicted 1465
14 SASI_Mm01_00223998 predicted 1466
15 SASI_Mm01_00224001 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430888 predicted 1060
2 SASI_Mm02_00430889 predicted 231
3 SASI_Mm02_00430890 predicted 1381
4 SASI_Mm02_00430891 predicted 1171
5 SASI_Mm02_00430892 predicted 1073
6 SASI_Mm02_00430893 predicted 1233
7 SASI_Mm02_00430894 predicted 380
8 SASI_Mm02_00430895 predicted 1146
9 SASI_Mm02_00430896 predicted 1285
10 SASI_Mm02_00430897 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012990
ARL13A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 13A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-797s1c1
Sequence:CCGGCTAGAACAATGCTCAATCGAACTCGAGTTCGATTGAGCATTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-848s1c1
Sequence:CCGGCTAGCCATCAAATCAATCCTACTCGAGTAGGATTGATTTGATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-299s1c1
Sequence:CCGGCTTTCCATCTATGACCTGAATCTCGAGATTCAGGTCATAGATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-793s1c1
Sequence:CCGGGCATCTAGAACAATGCTCAATCTCGAGATTGAGCATTGTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012990.1-650s1c1
Sequence:CCGGCGCTGGCTATTAGCTGTCATTCTCGAGAATGACAGCTAATAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-299s21c1
Sequence:GTACCGGGTTAGATGAGTATGAACTTTCCTCGAGGAAAGTTCATACTCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-400s21c1
Sequence:GTACCGGTCCTGGATTCCAGTGACATAACTCGAGTTATGTCACTGGAATCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-968s21c1
Sequence:GTACCGGTACGAAGCTTTGCTACAATTGCTCGAGCAATTGTAGCAAAGCTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-178s21c1
Sequence:GTACCGGATGTGACCATCCCTATCATTGCTCGAGCAATGATAGGGATGGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-828s21c1
Sequence:GTACCGGATCGAAGCTAAGCCTCTAAAGCTCGAGCTTTAGAGGCTTAGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-867s21c1
Sequence:GTACCGGGGTACGAGATTATGGTCTAAACTCGAGTTTAGACCATAATCTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-889s21c1
Sequence:GTACCGGAGAATATGTCAGTAACATTTGCTCGAGCAAATGTTACTGACATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-450s21c1
Sequence:GTACCGGACACATCTGCTGTCCGATAAACTCGAGTTTATCGGACAGCAGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012990
ARL13A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 13A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-797s1c1
Sequence:CCGGCTAGAACAATGCTCAATCGAACTCGAGTTCGATTGAGCATTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-848s1c1
Sequence:CCGGCTAGCCATCAAATCAATCCTACTCGAGTAGGATTGATTTGATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-299s1c1
Sequence:CCGGCTTTCCATCTATGACCTGAATCTCGAGATTCAGGTCATAGATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-793s1c1
Sequence:CCGGGCATCTAGAACAATGCTCAATCTCGAGATTGAGCATTGTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012990.1-650s1c1
Sequence:CCGGCGCTGGCTATTAGCTGTCATTCTCGAGAATGACAGCTAATAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-299s21c1
Sequence:GTACCGGGTTAGATGAGTATGAACTTTCCTCGAGGAAAGTTCATACTCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-400s21c1
Sequence:GTACCGGTCCTGGATTCCAGTGACATAACTCGAGTTATGTCACTGGAATCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-968s21c1
Sequence:GTACCGGTACGAAGCTTTGCTACAATTGCTCGAGCAATTGTAGCAAAGCTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-178s21c1
Sequence:GTACCGGATGTGACCATCCCTATCATTGCTCGAGCAATGATAGGGATGGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-828s21c1
Sequence:GTACCGGATCGAAGCTAAGCCTCTAAAGCTCGAGCTTTAGAGGCTTAGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-867s21c1
Sequence:GTACCGGGGTACGAGATTATGGTCTAAACTCGAGTTTAGACCATAATCTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-889s21c1
Sequence:GTACCGGAGAATATGTCAGTAACATTTGCTCGAGCAAATGTTACTGACATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-450s21c1
Sequence:GTACCGGACACATCTGCTGTCCGATAAACTCGAGTTTATCGGACAGCAGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012990
ARL13A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 13A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-797s1c1
Sequence:CCGGCTAGAACAATGCTCAATCGAACTCGAGTTCGATTGAGCATTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-848s1c1
Sequence:CCGGCTAGCCATCAAATCAATCCTACTCGAGTAGGATTGATTTGATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-299s1c1
Sequence:CCGGCTTTCCATCTATGACCTGAATCTCGAGATTCAGGTCATAGATGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012990.1-793s1c1
Sequence:CCGGGCATCTAGAACAATGCTCAATCTCGAGATTGAGCATTGTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012990.1-650s1c1
Sequence:CCGGCGCTGGCTATTAGCTGTCATTCTCGAGAATGACAGCTAATAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-299s21c1
Sequence:GTACCGGGTTAGATGAGTATGAACTTTCCTCGAGGAAAGTTCATACTCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-400s21c1
Sequence:GTACCGGTCCTGGATTCCAGTGACATAACTCGAGTTATGTCACTGGAATCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-968s21c1
Sequence:GTACCGGTACGAAGCTTTGCTACAATTGCTCGAGCAATTGTAGCAAAGCTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-178s21c1
Sequence:GTACCGGATGTGACCATCCCTATCATTGCTCGAGCAATGATAGGGATGGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-828s21c1
Sequence:GTACCGGATCGAAGCTAAGCCTCTAAAGCTCGAGCTTTAGAGGCTTAGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-867s21c1
Sequence:GTACCGGGGTACGAGATTATGGTCTAAACTCGAGTTTAGACCATAATCTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-889s21c1
Sequence:GTACCGGAGAATATGTCAGTAACATTTGCTCGAGCAAATGTTACTGACATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012990.3-450s21c1
Sequence:GTACCGGACACATCTGCTGTCCGATAAACTCGAGTTTATCGGACAGCAGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028947
ARL13A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 13A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-503s21c1
Sequence:CCGGGATCATCTTAACTCGCATAATCTCGAGATTATGCGAGTTAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028947.1-1438s21c1
Sequence:CCGGTACAAGTTCACGCACACTAACCTCGAGGTTAGTGTGCGTGAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-776s21c1
Sequence:CCGGTCGACAACAAATACCCAATATCTCGAGATATTGGGTATTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-963s21c1
Sequence:CCGGGAGGCAAGACAGCGCTTAATACTCGAGTATTAAGCGCTGTCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-1291s21c1
Sequence:CCGGGTGACTAAGCAGACGACTAAACTCGAGTTTAGTCGTCTGCTTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028947
ARL13A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 13A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-503s21c1
Sequence:CCGGGATCATCTTAACTCGCATAATCTCGAGATTATGCGAGTTAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028947.1-1438s21c1
Sequence:CCGGTACAAGTTCACGCACACTAACCTCGAGGTTAGTGTGCGTGAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-776s21c1
Sequence:CCGGTCGACAACAAATACCCAATATCTCGAGATATTGGGTATTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-963s21c1
Sequence:CCGGGAGGCAAGACAGCGCTTAATACTCGAGTATTAAGCGCTGTCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-1291s21c1
Sequence:CCGGGTGACTAAGCAGACGACTAAACTCGAGTTTAGTCGTCTGCTTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028947
ARL13A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 13A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-503s21c1
Sequence:CCGGGATCATCTTAACTCGCATAATCTCGAGATTATGCGAGTTAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028947.1-1438s21c1
Sequence:CCGGTACAAGTTCACGCACACTAACCTCGAGGTTAGTGTGCGTGAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-776s21c1
Sequence:CCGGTCGACAACAAATACCCAATATCTCGAGATATTGGGTATTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-963s21c1
Sequence:CCGGGAGGCAAGACAGCGCTTAATACTCGAGTATTAAGCGCTGTCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028947.1-1291s21c1
Sequence:CCGGGTGACTAAGCAGACGACTAAACTCGAGTTTAGTCGTCTGCTTAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks