EMAIL THIS PAGE TO A FRIEND

ARL13B

ADP-ribosylation factor-like 13B

105 Gene Product Result for
Synonyms: ARL2L1 JBTS8
UniProtKB ID: Q3SXY8, D3DN29, G3V1S8, Q504W8, Q8TCL5
Gene ID:
Human(200894) Summary: This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase that contains both N-terminal and C-terminal guanine nucleotide-binding motifs. This protein is localized in the cilia and plays a role in cilia formation and in maintenance of cilia. Mutations in this gene are the cause of Joubert syndrome 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(68146) ADP-ribosylation factor-like 13B
Rat(304037) ADP-ribosylation factor-like 13B
Zebrafish(286784) ADP-ribosylation factor-like 13b
cow(512781) ADP-ribosylation factor-like 13B
domestic cat(101080908) ADP-ribosylation factor-like 13B
dog(487934) ADP-ribosylation factor-like 13B
chicken(418431) ADP-ribosylation factor-like 13B
domestic guinea pig(100713646) ADP-ribosylation factor-like 13B
naked mole-rat(101723522) ADP-ribosylation factor-like 13B
sheep(101123516) ADP-ribosylation factor-like 13B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182896 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125871 MISSION® esiRNA esiRNA human ARL13B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144996 Rosetta Predictions human pricing
NM_182896 Rosetta Predictions human pricing
NM_001107101 Rosetta Predictions rat pricing
NM_026577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155669 predicted 1037
2 SASI_Hs01_00155670 predicted 1028
3 SASI_Hs01_00155671 predicted 1027
4 SASI_Hs01_00155672 predicted 997
5 SASI_Hs01_00155673 predicted 1001
6 SASI_Hs01_00155674 predicted 1023
7 SASI_Hs01_00155675 predicted 1028
8 SASI_Hs01_00155676 predicted 1033
9 SASI_Hs01_00155677 predicted 1042
10 SASI_Hs01_00155678 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081609 predicted 1351
2 SASI_Hs01_00081610 predicted 1352
3 SASI_Hs01_00081611 predicted 1348
4 SASI_Hs01_00081612 predicted 1318
5 SASI_Hs01_00081613 predicted 1319
6 SASI_Hs01_00081614 predicted 1351
7 SASI_Hs01_00081615 predicted 1347
8 SASI_Hs01_00081616 predicted 1354
9 SASI_Hs01_00081617 predicted 1359
10 SASI_Hs01_00081618 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225506 predicted 619
2 SASI_Rn02_00225507 predicted 1357
3 SASI_Rn02_00225508 predicted 1539
4 SASI_Rn02_00225509 predicted 655
5 SASI_Rn02_00225510 predicted 776
6 SASI_Rn02_00225511 predicted 369
7 SASI_Rn02_00225512 predicted 634
8 SASI_Rn02_00225513 predicted 1475
9 SASI_Rn02_00225514 predicted 710
10 SASI_Rn02_00225515 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106472 predicted 867
2 SASI_Mm01_00106474 predicted 355
3 SASI_Mm01_00106475 predicted 584
4 SASI_Mm01_00106476 predicted 649
5 SASI_Mm01_00106477 predicted 774
6 SASI_Mm01_00106478 predicted 637
7 SASI_Mm01_00106479 predicted 1367
8 SASI_Mm01_00106480 predicted 1497
9 SASI_Mm01_00106481 predicted 1541
10 SASI_Mm02_00330537 predicted 1025
11 SASI_Mm01_00106473 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026577
VALIDATED
ARL13B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 13B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-1561s21c1
Sequence:GTACCGGGCTCAGGACACGATCTCATAACTCGAGTTATGAGATCGTGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-371s21c1
Sequence:GTACCGGTGATGGTCGGCCTTGATAATGCTCGAGCATTATCAAGGCCGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026577.2-2845s1c1
Sequence:CCGGGCAATGAACATACACTGGTTTCTCGAGAAACCAGTGTATGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026577.2-349s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACACTTCTCGAGAAGTGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-378s1c1
Sequence:CCGGCGGCCTTGATAATGCTGGTAACTCGAGTTACCAGCATTATCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-1376s1c1
Sequence:CCGGCAGTCAATACAGACGAGTCTACTCGAGTAGACTCGTCTGTATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-868s1c1
Sequence:CCGGGCAAAGGACTTTGATGCCTTACTCGAGTAAGGCATCAAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026577
VALIDATED
ARL13B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 13B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-1561s21c1
Sequence:GTACCGGGCTCAGGACACGATCTCATAACTCGAGTTATGAGATCGTGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-371s21c1
Sequence:GTACCGGTGATGGTCGGCCTTGATAATGCTCGAGCATTATCAAGGCCGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026577.2-2845s1c1
Sequence:CCGGGCAATGAACATACACTGGTTTCTCGAGAAACCAGTGTATGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026577.2-349s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACACTTCTCGAGAAGTGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-378s1c1
Sequence:CCGGCGGCCTTGATAATGCTGGTAACTCGAGTTACCAGCATTATCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-1376s1c1
Sequence:CCGGCAGTCAATACAGACGAGTCTACTCGAGTAGACTCGTCTGTATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-868s1c1
Sequence:CCGGGCAAAGGACTTTGATGCCTTACTCGAGTAAGGCATCAAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026577
VALIDATED
ARL13B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 13B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-1561s21c1
Sequence:GTACCGGGCTCAGGACACGATCTCATAACTCGAGTTATGAGATCGTGTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026577.3-371s21c1
Sequence:GTACCGGTGATGGTCGGCCTTGATAATGCTCGAGCATTATCAAGGCCGACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026577.2-2845s1c1
Sequence:CCGGGCAATGAACATACACTGGTTTCTCGAGAAACCAGTGTATGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026577.2-349s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACACTTCTCGAGAAGTGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-378s1c1
Sequence:CCGGCGGCCTTGATAATGCTGGTAACTCGAGTTACCAGCATTATCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-1376s1c1
Sequence:CCGGCAGTCAATACAGACGAGTCTACTCGAGTAGACTCGTCTGTATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026577.2-868s1c1
Sequence:CCGGGCAAAGGACTTTGATGCCTTACTCGAGTAAGGCATCAAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182896
VALIDATED
ARL13B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 13B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-643s21c1
Sequence:CCGGGATATCGGGAAAGCCTATATTCTCGAGAATATAGGCTTTCCCGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182896.1-2051s21c1
Sequence:CCGGCATCGTAATTTGACCTAATTTCTCGAGAAATTAGGTCAAATTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1252s21c1
Sequence:GTACCGGGGCATTAACACAGCAGTTAAACTCGAGTTTAACTGCTGTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1296s21c1
Sequence:GTACCGGCATCATTGGAATCAGCTAATGCTCGAGCATTAGCTGATTCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1356s21c1
Sequence:CCGGACCGGGTAGAACCACTTAATACTCGAGTATTAAGTGGTTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-873s1c1
Sequence:CCGGCCTTAAATGAACGCATCCAAACTCGAGTTTGGATGCGTTCATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-338s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACTCTTCTCGAGAAGAGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1057s1c1
Sequence:CCGGCCAGCCAATAGCATCTGTAATCTCGAGATTACAGATGCTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1357s1c1
Sequence:CCGGCCGGGTAGAACCACTTAATATCTCGAGATATTAAGTGGTTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_182896.1-656s1c1
Sequence:CCGGCCTATATTGGTGTTGGCAAATCTCGAGATTTGCCAACACCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182896
VALIDATED
ARL13B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 13B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-643s21c1
Sequence:CCGGGATATCGGGAAAGCCTATATTCTCGAGAATATAGGCTTTCCCGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182896.1-2051s21c1
Sequence:CCGGCATCGTAATTTGACCTAATTTCTCGAGAAATTAGGTCAAATTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1252s21c1
Sequence:GTACCGGGGCATTAACACAGCAGTTAAACTCGAGTTTAACTGCTGTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1296s21c1
Sequence:GTACCGGCATCATTGGAATCAGCTAATGCTCGAGCATTAGCTGATTCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1356s21c1
Sequence:CCGGACCGGGTAGAACCACTTAATACTCGAGTATTAAGTGGTTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-873s1c1
Sequence:CCGGCCTTAAATGAACGCATCCAAACTCGAGTTTGGATGCGTTCATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-338s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACTCTTCTCGAGAAGAGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1057s1c1
Sequence:CCGGCCAGCCAATAGCATCTGTAATCTCGAGATTACAGATGCTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1357s1c1
Sequence:CCGGCCGGGTAGAACCACTTAATATCTCGAGATATTAAGTGGTTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_182896.1-656s1c1
Sequence:CCGGCCTATATTGGTGTTGGCAAATCTCGAGATTTGCCAACACCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182896
VALIDATED
ARL13B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 13B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-643s21c1
Sequence:CCGGGATATCGGGAAAGCCTATATTCTCGAGAATATAGGCTTTCCCGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182896.1-2051s21c1
Sequence:CCGGCATCGTAATTTGACCTAATTTCTCGAGAAATTAGGTCAAATTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1252s21c1
Sequence:GTACCGGGGCATTAACACAGCAGTTAAACTCGAGTTTAACTGCTGTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1296s21c1
Sequence:GTACCGGCATCATTGGAATCAGCTAATGCTCGAGCATTAGCTGATTCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182896.1-1356s21c1
Sequence:CCGGACCGGGTAGAACCACTTAATACTCGAGTATTAAGTGGTTCTACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-873s1c1
Sequence:CCGGCCTTAAATGAACGCATCCAAACTCGAGTTTGGATGCGTTCATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-338s1c1
Sequence:CCGGCCTGTCAGAAAGGTGACTCTTCTCGAGAAGAGTCACCTTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1057s1c1
Sequence:CCGGCCAGCCAATAGCATCTGTAATCTCGAGATTACAGATGCTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182896.1-1357s1c1
Sequence:CCGGCCGGGTAGAACCACTTAATATCTCGAGATATTAAGTGGTTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_182896.1-656s1c1
Sequence:CCGGCCTATATTGGTGTTGGCAAATCTCGAGATTTGCCAACACCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks