EMAIL THIS PAGE TO A FRIEND

ARL14

ADP-ribosylation factor-like 14

149 Gene Product Result for
Synonyms: ARF7
UniProtKB ID: Q8N4G2, Q9H655
Gene ID:
Mouse(71619) ADP-ribosylation factor-like 14
Rat(683581) ADP-ribosylation factor-like 14
sheep(101105298) ADP-ribosylation factor-like 14
naked mole-rat(101704586) ADP-ribosylation factor-like 14
domestic guinea pig(100729289) ADP-ribosylation factor-like 14
Zebrafish(556921) ADP-ribosylation factor-like 14
dog(488134) ADP-ribosylation factor-like 14
cow(539937) ADP-ribosylation factor-like 14
domestic cat(101093206) ADP-ribosylation factor-like 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031581 MISSION® esiRNA esiRNA human ARL14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025047 Rosetta Predictions human pricing
XM_001066622 Rosetta Predictions rat pricing
XM_130919 Rosetta Predictions mouse pricing
XM_913399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042862 predicted 735
2 SASI_Hs01_00042863 predicted 583
3 SASI_Hs01_00042864 predicted 953
4 SASI_Hs02_00357696 predicted 597
5 SASI_Hs01_00042867 predicted 795
6 SASI_Hs01_00042868 predicted 903
7 SASI_Hs01_00042869 predicted 907
8 SASI_Hs02_00357697 predicted 695
9 SASI_Hs02_00357698 predicted 1041
10 SASI_Hs01_00042870 predicted 802
11 SASI_Hs01_00042865 predicted 1017
12 SASI_Hs01_00042866 predicted 839
13 SASI_Hs01_00042871 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318181 predicted 369
2 SASI_Rn02_00318182 predicted 431
3 SASI_Rn02_00318183 predicted 373
4 SASI_Rn02_00318184 predicted 355
5 SASI_Rn02_00318185 predicted 370
6 SASI_Rn02_00318186 predicted 203
7 SASI_Rn02_00318187 predicted 380
8 SASI_Rn02_00318188 predicted 471
9 SASI_Rn02_00318189 predicted 453
10 SASI_Rn02_00318190 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208372 predicted 952
2 SASI_Mm01_00208373 predicted 792
3 SASI_Mm01_00208374 predicted 910
4 SASI_Mm01_00208375 predicted 234
5 SASI_Mm01_00208376 predicted 889
6 SASI_Mm01_00208378 predicted 744
7 SASI_Mm02_00424405 predicted 801
8 SASI_Mm01_00208379 predicted 925
9 SASI_Mm02_00424406 predicted 667
10 SASI_Mm01_00208380 predicted 931
11 SASI_Mm01_00208377 predicted 404
12 SASI_Mm01_00208381 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437682 predicted 951
2 SASI_Mm02_00437683 predicted 796
3 SASI_Mm02_00437684 predicted 903
4 SASI_Mm02_00437685 predicted 233
5 SASI_Mm02_00437686 predicted 893
6 SASI_Mm02_00437687 predicted 748
7 SASI_Mm02_00437688 predicted 801
8 SASI_Mm02_00437689 predicted 923
9 SASI_Mm02_00437690 predicted 671
10 SASI_Mm02_00437691 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025047
ARL14 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 14
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025047.1-873s1c1
Sequence:CCGGCCTGAGATGTTATTTCATCTACTCGAGTAGATGAAATAACATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-329s1c1
Sequence:CCGGCAATGTGGAAATGATCGAGTTCTCGAGAACTCGATCATTTCCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-540s1c1
Sequence:CCGGGTTGTTCTATTAGCCAACAAACTCGAGTTTGTTGGCTAATAGAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-489s1c1
Sequence:CCGGCAGAGACAGTTTGAGCACATTCTCGAGAATGTGCTCAAACTGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-539s1c1
Sequence:CCGGTGTTGTTCTATTAGCCAACAACTCGAGTTGTTGGCTAATAGAACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-531s21c1
Sequence:GTACCGGATGTGCCTGTTGTTCTATTAGCTCGAGCTAATAGAACAACAGGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-302s21c1
Sequence:GTACCGGATTACCACCATCCCTACAATACTCGAGTATTGTAGGGATGGTGGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-342s21c1
Sequence:GTACCGGTCGAGTTGGAAAGGAATCTTTCTCGAGAAAGATTCCTTTCCAACTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1092s21c1
Sequence:GTACCGGTAGTAAGCTGTCTGCTAATAGCTCGAGCTATTAGCAGACAGCTTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1160s21c1
Sequence:GTACCGGTCCACCGTGCTCCTATGTAACCTCGAGGTTACATAGGAGCACGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-591s21c1
Sequence:GTACCGGACATCACCAGAATGTTCAAAGCTCGAGCTTTGAACATTCTGGTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-625s21c1
Sequence:GTACCGGCAGTGACCGGAACTGGTATGTCTCGAGACATACCAGTTCCGGTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025047
ARL14 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 14
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025047.1-873s1c1
Sequence:CCGGCCTGAGATGTTATTTCATCTACTCGAGTAGATGAAATAACATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-329s1c1
Sequence:CCGGCAATGTGGAAATGATCGAGTTCTCGAGAACTCGATCATTTCCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-540s1c1
Sequence:CCGGGTTGTTCTATTAGCCAACAAACTCGAGTTTGTTGGCTAATAGAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-489s1c1
Sequence:CCGGCAGAGACAGTTTGAGCACATTCTCGAGAATGTGCTCAAACTGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-539s1c1
Sequence:CCGGTGTTGTTCTATTAGCCAACAACTCGAGTTGTTGGCTAATAGAACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-531s21c1
Sequence:GTACCGGATGTGCCTGTTGTTCTATTAGCTCGAGCTAATAGAACAACAGGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-302s21c1
Sequence:GTACCGGATTACCACCATCCCTACAATACTCGAGTATTGTAGGGATGGTGGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-342s21c1
Sequence:GTACCGGTCGAGTTGGAAAGGAATCTTTCTCGAGAAAGATTCCTTTCCAACTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1092s21c1
Sequence:GTACCGGTAGTAAGCTGTCTGCTAATAGCTCGAGCTATTAGCAGACAGCTTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1160s21c1
Sequence:GTACCGGTCCACCGTGCTCCTATGTAACCTCGAGGTTACATAGGAGCACGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-591s21c1
Sequence:GTACCGGACATCACCAGAATGTTCAAAGCTCGAGCTTTGAACATTCTGGTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-625s21c1
Sequence:GTACCGGCAGTGACCGGAACTGGTATGTCTCGAGACATACCAGTTCCGGTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025047
ARL14 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 14
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025047.1-873s1c1
Sequence:CCGGCCTGAGATGTTATTTCATCTACTCGAGTAGATGAAATAACATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-329s1c1
Sequence:CCGGCAATGTGGAAATGATCGAGTTCTCGAGAACTCGATCATTTCCACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-540s1c1
Sequence:CCGGGTTGTTCTATTAGCCAACAAACTCGAGTTTGTTGGCTAATAGAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-489s1c1
Sequence:CCGGCAGAGACAGTTTGAGCACATTCTCGAGAATGTGCTCAAACTGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025047.1-539s1c1
Sequence:CCGGTGTTGTTCTATTAGCCAACAACTCGAGTTGTTGGCTAATAGAACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-531s21c1
Sequence:GTACCGGATGTGCCTGTTGTTCTATTAGCTCGAGCTAATAGAACAACAGGCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-302s21c1
Sequence:GTACCGGATTACCACCATCCCTACAATACTCGAGTATTGTAGGGATGGTGGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-342s21c1
Sequence:GTACCGGTCGAGTTGGAAAGGAATCTTTCTCGAGAAAGATTCCTTTCCAACTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1092s21c1
Sequence:GTACCGGTAGTAAGCTGTCTGCTAATAGCTCGAGCTATTAGCAGACAGCTTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025047.2-1160s21c1
Sequence:GTACCGGTCCACCGTGCTCCTATGTAACCTCGAGGTTACATAGGAGCACGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-591s21c1
Sequence:GTACCGGACATCACCAGAATGTTCAAAGCTCGAGCTTTGAACATTCTGGTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025047.2-625s21c1
Sequence:GTACCGGCAGTGACCGGAACTGGTATGTCTCGAGACATACCAGTTCCGGTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027843
ARL14 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-184s21c1
Sequence:CCGGTACTCTGCTTTACCGGTTAAACTCGAGTTTAACCGGTAAAGCAGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-601s21c1
Sequence:CCGGTGACGGGTTCAGGAAATTAACCTCGAGGTTAATTTCCTGAACCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-235s21c1
Sequence:CCGGCATCGGCTTCAACGTGGAAATCTCGAGATTTCCACGTTGAAGCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-669s21c1
Sequence:CCGGTCAAGCAGAAATGAGACAATGCTCGAGCATTGTCTCATTTCTGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027843.1-885s21c1
Sequence:CCGGGATGATTTGAAAGTCCTATTTCTCGAGAAATAGGACTTTCAAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027843
ARL14 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-184s21c1
Sequence:CCGGTACTCTGCTTTACCGGTTAAACTCGAGTTTAACCGGTAAAGCAGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-601s21c1
Sequence:CCGGTGACGGGTTCAGGAAATTAACCTCGAGGTTAATTTCCTGAACCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-235s21c1
Sequence:CCGGCATCGGCTTCAACGTGGAAATCTCGAGATTTCCACGTTGAAGCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-669s21c1
Sequence:CCGGTCAAGCAGAAATGAGACAATGCTCGAGCATTGTCTCATTTCTGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027843.1-885s21c1
Sequence:CCGGGATGATTTGAAAGTCCTATTTCTCGAGAAATAGGACTTTCAAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027843
ARL14 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-184s21c1
Sequence:CCGGTACTCTGCTTTACCGGTTAAACTCGAGTTTAACCGGTAAAGCAGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-601s21c1
Sequence:CCGGTGACGGGTTCAGGAAATTAACCTCGAGGTTAATTTCCTGAACCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-235s21c1
Sequence:CCGGCATCGGCTTCAACGTGGAAATCTCGAGATTTCCACGTTGAAGCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027843.1-669s21c1
Sequence:CCGGTCAAGCAGAAATGAGACAATGCTCGAGCATTGTCTCATTTCTGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027843.1-885s21c1
Sequence:CCGGGATGATTTGAAAGTCCTATTTCTCGAGAAATAGGACTTTCAAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)